<< back to search

Search Details

add to cart



UAMH Number:1704
Species Name: Uncinocarpus reesii
Type:
Synonyms: Gymnoascus siglerae
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Onygenaceae
Strain History: Orr, G.F. (O-2080) -> UAMH
Substrate: soil
Location: USA California, SW of Greenfield
Isolator: G.F. Orr
Isolation Date: 1960
Date Received: 1963-07-10
Characters: MOLECULAR SYSTEMATICS geneologies based on genes coding for orotidine 5(prime) monophosphate decarboxylase, chitin synthase & human T-cell reactive protein - Koufopanou, Burt, Szaro & Taylor, Mol. Biol. Evol. 18:1246-1256, 2001 // MOLECULAR SYSTEMATICS genome sequence under the number 1704, Broad Institute - https://genome.jgi.doe.gov/Uncre1/Uncre1.home.html // MOLECULAR SYSTEMATICS proline-rich antigen (PRA) gene - Johannesson H, Vidal P, Guarro J, Herr RA, Cole GT, Taylor JW, Mol Biol Evol 21:1134-1145, 2004 // SYSTEMATICS/ TAXONOMY mating studies - Sigler & Carmichael, Mycotaxon 4:462-471, 1976
Compounds:
Cross Reference:
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
Regulatory Requirements: No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 325245
Sequences: >UAMH01704_AJ292093_chitin synthase AACACCTGGGGAAAGGAGGCATGGAAGAAGATCGTGGTCTGTGTCGTCAGCGATGGCCGTGCAAAGATCAATCCCAGAACACGGGCGGTTCTGGCCGGTTTGGGGGTGTATCAAGATGGAATTGCCAAGCAGCAAGTCAACGGAAAGGACGTGACTGCTCACATCTATGAATATACAACTCAAATGGGCATGGAGTTGAAAGGCAACCAAGTGCTCCTCAAGCCGCGACGGGGTATGCCCGTTCAAATGCTGTTTTGCTTAAAGGAAAAGAACCAAAAGAAAATCAACTCCCACCGTTGGTTCTTTCAAGCGTTCGGACGTGTCCTGGATCCGAATATTTGCGTCCTTCTTGACGCAGGTACCAAACCA >UAMH01704_AJ292108_pyrG GACTTCTCCTCCGAAACCATCGCCGGCCTCCAATCCCTGTCCCAAAAACACAACTTCCTCATCTTCGAAGACCGAAAGTTCGTCGATATCGGAAACACGGTGCAAAAGCAGTATCATGGCGGTGCATTGCAGATCTCACAATGGGCGCATATCGTCAATGCCACCATGCTTCCCGGCCCAGGGATCATAGACGCGCTGGCACAGGTGGCTTCAGCGCCGGACTTTCCCCATGCGGCGCACAGAGGGCTCTTGATCCTCGCAGAAATGACGTCGAAGGGCAGCCTGGCCACCGGCAAATACACGGAGCTTTCGGTGGAGATGGCGCGGAAATATAGGGGCTTTGTTCTGGGGTTTGTGGCTACGAGATCTCTGGCGGATGTGGACACGGCTGCAAAG >UAMH01704_AJ291973_tcrP GATATCTACACGTAAGTGATCTGATCCGAGTCATGCAGTGGTCACAACGATGGCTAACCGTTGAAATAGCGAATTCTCCGCTCTGAAGAGTATTGTCATGGCATCGCCAAATGATGTCGTCAAAATGCCAATCAACGAGCCCGCGAAGGGAAAGAAGCAATCCCAGATCGAGGAATATGTCGACTTCTACAGCGGTGCTGGTGTGCAACACATTGCGCTCCGAACTGACAACATCATCAACGCGATCACCAACCTCAGGGCTCGCGGTGTGGAGTTCATCAAGGTTCCCAGCACCTACTATGATGACATCAAGCTTCGCCTCAAGAAACAGGGCTTAGTCCTCAACGAAGATCTTGAAACCTTGCAGAGCCTAGATATCCTCATCGACTTCGATGAGAACGGCTATCTCTTGCAGCTTTTCACAAAGGTATGCGCCCTGGTCGTGTGACTTCGATTCTGATATAACTCCTGCTAACGGTATCCGCAGCACCTCATGGACCGGCCAACC

IMAGES:

LOCATION: