| UAMH Number: | 10103 |
|---|---|
| Species Name: | unidentified sp. |
| Type: | |
| Synonyms: | |
| Taxonomy: | |
| Strain History: | Allen, T.R. (UBCtra 300) -> UAMH |
| Substrate: | ericoid root associated fungus, Gaultheria shallon | Location: | CANADA British Columbia, Vancouver Island, north island (GEO: 49.651,-125.449) |
| Isolator: | T.R. Allen |
| Isolation Date: | |
| Date Received: | 2001-12-07 |
| Characters: | CELLULOLYTIC - // MOLECULAR SYSTEMATICS DNA and culture-based detection of ericoid mycorrhizal fungi - Allen TR, Millar T, Berch SM, Berbee ML, New Phytologist 160:255-272, 2003 // MOLECULAR SYSTEMATICS placed within Leotiales based on sequences 5.8S, ITS1/2, 18S, 28S rRNA gene - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 // MYCORRHIZAE ericoid endophyte (salal) - fide T.R. Allen // ODOR/ ODOUR astringent - (Click for publications citing UAMH 10103) |
| Compounds: | |
| Cross Reference: | |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: no | Animal: no | Plant: no |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 0 |
| Sequences: | >UAMH10103_AF149079_SSU-LSU CATTACAGAGTTGCAAAACTCCCAAACCATCGCGAACTTACCGTACCGTTGCTTCGGCGAGGGGCTCCGGGGAGGAGCCGCGGCCCTAACGGGTGCTCGCCGCAAGCCCAACAACTCTGAATTCTTGGTATCTCTGAGTATAACATACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAGGCCCCCGGGCCCGTGTTGGGGCACTGCGCGCCAGCCGCGCAGGCTCTCAAAACCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAACATATCTCGCTTTGGACGCGCGGTGGGCGCTTGCCGTAAAACACCCCCCTTCTCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAAC |
There are no images in this gallery.