UofT DLSPH Webmail Portal LIMS
<< back to search

UAMH 10104 — Capronia sp.

add to cart

UAMH Number:10104
Species Name: Capronia sp.
Type:
Synonyms: Didymotrichiella / Polytrichiellashow more
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Chaetothyriales, Herpotrichiellaceae
Strain History: Allen, T.R. (UBCtra 1046) -> UAMH
Substrate: ericoid mycorrhizae, Gaultheria shallon (salal)
Location: CANADA British Columbia, Vancouver Island, north island (GEO: 49.651,-125.449)
Isolator: T.R. Allen
Isolation Date:
Date Received: 2001-12-07
Characters: CULTURE CONDITIONS very slow growing; better on CER than PDA // MOLECULAR SYSTEMATICS DNA and culture-based detection of ericoid mycorrhizal fungi - Allen TR, Millar T, Berch SM, Berbee ML, New Phytologist 160:255-272, 2003 // MOLECULAR SYSTEMATICS placed within the Herpotrichiellaceae based on partial sequence 5.8S, ITS2, 28S rRNA gene sequences - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 // MYCORRHIZAE ericoid - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 (Click for publications citing UAMH 10104)
Compounds:
Cross Reference:
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: unknown | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 815
NCBI Taxonomy ID: 43220
GBIF Taxon Key: 2569892
Sequences:

>UAMH10104_AF300734_LSU CAGTGAGTCATCGAATCTTTGAACGCATATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCAACCATCAAGCCTGGCTTGTCGTTGGACTCTTTTTACCGCTGAAATATGTGGTAGGTCCGAAAGATAATGACGGCGTCGTGTTTGACCCTAGATGCAACGAGCTTTTTATAGCACGCATTGAAGTGGTCGACCGACCCGGTCTTTAACCATCATTTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGC

Images