| UAMH Number: | 10329 |
|---|---|
| Species Name: | Hyaloscypha hepaticicola |
| Type: | |
| Synonyms: | Hyaloscypha hepaticola / Hymenoscyphus ericae / Pezizella ericae / Pezoloma ericae / Rhizoscyphus ericae / Scytalidium vaccinii / Trichopeziza hepaticicola / Trichopeziza hepaticola |
| Taxonomy: | FUNGI Ascomycota, Leotiomycetes, Helotiales, Hyaloscyphaceae |
| Strain History: | T.R. Allen -> Berbee, M.L. (UBCtra 1317C) -> UAMH |
| Substrate: | roots of salal (Gaultheria shallon) | Location: | CANADA British Columbia, Vancouver Island, north island (GEO: 49.651,-125.449) |
| Isolator: | T.R. Allen |
| Isolation Date: | 1999-01-?? |
| Date Received: | 2003-07-30 |
| Characters: | CULTURE CONDITIONS produces arthroconidia - fide UAMH // MOLECULAR SYSTEMATICS DNA and culture-based detection of ericoid mycorrhizal fungi - Allen TR, Millar T, Berch SM, Berbee ML, New Phytologist 160:255-272, 2003 // MOLECULAR SYSTEMATICS ericoid mycorrhizal fungi - Berch S, Allen TR, Berbee ML, Plant and Soil 244:55-66, 2002 // MOLECULAR SYSTEMATICS Rhizoscyphus, a new genus for Ericaceae-associated Hymenoscyphus ericae and H. monotropae - Zhang Y-H, Zhuang W-Y, Nova Hedwigia 78:475-484, 2004 (Click for publications citing UAMH 10329) |
| Compounds: | |
| Cross Reference: | |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: no | Animal: no | Plant: yes |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 522192 |
| Sequences: | >UAMH10329_AF300748_LSU GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATGACCACTCAAGCCTAGCTTGGTATTGGGGTTCGCGGTCTCGCGGCCCTTAAAATCAGTGGCGGTGCCATCTGGCTCTAAGCGTAGTAATTTATCTCGCTATTGGGTCCGGTGGTTACTTGCCAACAACCCCCAACTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT |
There are no images in this gallery.