<< back to search

Search Details

add to cart



UAMH Number:10385
Species Name: Mucor circinelloides
Type:
Synonyms: Calyptromyces circinelloides / Circinomucor circinelloides / Mucor alternans / Mucor ambiguus / Mucor circinelloides var. circinelloides / Mucor circinelloides var. mandshuricus / Mucor dubius / Mucor griseoroseus / Mucor javanicus / Mucor mandshuricus / Mucor prainii / Mucor ramificus / Rhizomucor regularior / Rhizomucor variabilis var. regularior
Taxonomy: FUNGI Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae
Strain History: Iwen, P. (UNMC 090803) -> UAMH
Substrate: ulcer on left calf, male 90 yr; biopsy + for hyphae with few septa and thick-walled yeast forms
Location: USA Nebraska, Omaha, University of Nebraska Medical Center (GEO: 41.255,-95.976)
Isolator: P. Iwen
Isolation Date: 2016-03-10
Date Received: 2003-12-22
Characters: CULTURE CONDITIONS no zygospores in matings with UAMH 8306 or 8307 - // HUMAN/ ANIMAL PATHOGEN primary cutaneous infection - Iwen PC, Sigler L, Freifeld AG, J Clin Microbiol 45:636-640, 2007 // MOLECULAR SYSTEMATICS ITS sequence comparison showed 99% similarity with GenBank sequence for Mucor circinelloides - (Click for publications citing UAMH 10385)
Compounds:
Cross Reference: UNMC 090803
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) and a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 198947
Sequences:

>UAMH10385_DQ787159_SSU-LSU AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAATAATCAATAATTTTGGCTTGTCCATTATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAGGGATGCTCCACTGCTATAAGGATAGGCGATGGAGATGCTAACCGAGTCATAATCAAGCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAGACATTTTGTTGAATAGGAATACTGAGAGTCTCTTGATCTATTCTGATCTCGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTTTGAATGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGGTAAACTGTGCTGGGGCCTCCCAAATAATACTTTTTTTAAATTTGATCTAAATCAGGCGGGA


IMAGES: