| UAMH Number: | 1592 |
|---|---|
| Species Name: | Malbranchea sp. |
| Type: | |
| Synonyms: | Auxarthron |
| Taxonomy: | FUNGI Ascomycota, Eurotiomycetes, Onygenales, Onygenaceae |
| Strain History: | Orr, G.F. (O-2016) -> UAMH |
| Substrate: | pack rat dung | Location: | USA California, Kern County, Weldon Valley (GEO: 35.666,-118.29) |
| Isolator: | G.F. Orr |
| Isolation Date: | 1960 |
| Date Received: | 1963-03-08 |
| Characters: | MOLECULAR SYSTEMATICS Determined as Auxarthron conjugatum G.F. Orr - // MOLECULAR SYSTEMATICS Determined as Auxarthron sp. based on ITS sequence - fide S. Hambleton (Click for publications citing UAMH 1592) |
| Compounds: | |
| Cross Reference: | |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: yes | Animal: no | Plant: no |
| Biosafety Risk Group: | RG2 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 8833 |
| Sequences: | >UAMH01592_KC470856_SSU-LSU CATTACAGTGTTCCGTCGCGGCGCGCCGGGCCTTCAAGCCCGTGTGTTGTCGCGCGAAACCCCACCCTTGACTATTGAACTACATGTTGCTTTGGCGGGCCCGCCCCAGGGCCGCCGGGAGCTCTGGCTCCTGGCCCGCGCCCGCCAGAGGTAAACTTGAACTCTTTTATGAACTGGCCGTCTGAGTATGATATTGAATCATCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTCGTCCCCCGTGGACGGGTCCGAAAGGCAGTGGCGGCGTCCCGACATGGTGCCCGAGCGTATGGGAACTCTCTTCCGCTCGAACAGGCCCGGTCGGCGCTGGTCGTAACCAAATTTTTTACCGGTTGACCTCGGATCAGGTAGGG |
There are no images in this gallery.