<< back to search

Search Details

add to cart



UAMH Number:1704
Species Name: Uncinocarpus reesii
Type:
Substrate: soil
Location: USA: California, SW of Greenfield
Isolator: G.F. Orr
Isolation Date: 1960
Characters: molecular systematics, geneologies based on genes coding for orotidine 5(prime) monophosphate decarboxylase, chitin synthase & human T-cell reactive protein, Koufopanou, Burt, Szaro & Taylor, Mol. Biol. Evol. 18:1246-1256, 2001 // molecular systematics, genome sequence under the number 1704, Broad Institute (http://www.broad.mit.edu/annotation/genome/uncinocarpus_reesii/Info.html) // molecular systematics, proline-rich antigen (PRA) gene, Johannesson H, Vidal P, Guarro J, Herr RA, Cole GT, Taylor JW, Mol Biol Evol 21:1134-1145, 2004 // systematics/taxonomy, mating studies, Sigler & Carmichael, Mycotaxon 4:462-471, 1976
Compounds:
Cross Reference: GenBank AAIW00000000 // GenBank AAIW01000001 to A // GenBank AAIW01000583 mito // GenBank AJ291973 partial // GenBank AJ292093 (chitin // GenBank AJ292108 (OMPD)
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
MycoBank ID: 325245
Sequences: >UAMH01704_AJ291973 GATATCTACACGTAAGTGATCTGATCCGAGTCATGCAGTGGTCACAACGATGGCTAACCGTTGAAATAGCGAATTCTCCGCTCTGAAGAGTATTGTCATGGCATCGCCAAATGATGTCGTCAAAATGCCAATCAACGAGCCCGCGAAGGGAAAGAAGCAATCCCAGATCGAGGAATATGTCGACTTCTACAGCGGTGCTGGTGTGCAACACATTGCGCTCCGAACTGACAACATCATCAACGCGATCACCAACCTCAGGGCTCGCGGTGTGGAGTTCATCAAGGTTCCCAGCACCTACTATGATGACATCAAGCTTCGCCTCAAGAAACAGGGCTTAGTCCTCAACGAAGATCTTGAAACCTTGCAGAGCCTAGATATCCTCATCGACTTCGATGAGAACGGCTATCTCTTGCAGCTTTTCACAAAGGTATGCGCCCTGGTCGTGTGACTTCGATTCTGATATAACTCCTGCTAACGGTATCCGCAGCACCTCATGGACCGGCCAACC >UAMH01704_AJ292093 AACACCTGGGGAAAGGAGGCATGGAAGAAGATCGTGGTCTGTGTCGTCAGCGATGGCCGTGCAAAGATCAATCCCAGAACACGGGCGGTTCTGGCCGGTTTGGGGGTGTATCAAGATGGAATTGCCAAGCAGCAAGTCAACGGAAAGGACGTGACTGCTCACATCTATGAATATACAACTCAAATGGGCATGGAGTTGAAAGGCAACCAAGTGCTCCTCAAGCCGCGACGGGGTATGCCCGTTCAAATGCTGTTTTGCTTAAAGGAAAAGAACCAAAAGAAAATCAACTCCCACCGTTGGTTCTTTCAAGCGTTCGGACGTGTCCTGGATCCGAATATTTGCGTCCTTCTTGACGCAGGTACCAAACCA >UAMH01704_AJ292108 GACTTCTCCTCCGAAACCATCGCCGGCCTCCAATCCCTGTCCCAAAAACACAACTTCCTCATCTTCGAAGACCGAAAGTTCGTCGATATCGGAAACACGGTGCAAAAGCAGTATCATGGCGGTGCATTGCAGATCTCACAATGGGCGCATATCGTCAATGCCACCATGCTTCCCGGCCCAGGGATCATAGACGCGCTGGCACAGGTGGCTTCAGCGCCGGACTTTCCCCATGCGGCGCACAGAGGGCTCTTGATCCTCGCAGAAATGACGTCGAAGGGCAGCCTGGCCACCGGCAAATACACGGAGCTTTCGGTGGAGATGGCGCGGAAATATAGGGGCTTTGTTCTGGGGTTTGTGGCTACGAGATCTCTGGCGGATGTGGACACGGCTGCAAAG

IMAGES:

LOCATION: