<< back to search

Search Details

add to cart



UAMH Number:1704
Species Name: Uncinocarpus reesii
Type:
Strain History: Orr, G.F. (O-2080) -> UAMH
Substrate: soil
Location: USA California, SW of Greenfield
Isolator: G.F. Orr
Isolation Date: 1960
Characters: molecular systematics geneologies based on genes coding for orotidine 5(prime) monophosphate decarboxylase, chitin synthase & human T-cell reactive protein - Koufopanou, Burt, Szaro & Taylor, Mol. Biol. Evol. 18:1246-1256, 2001 // molecular systematics genome sequence under the number 1704 - Broad Institute (http://www.broad.mit.edu/annotation/genome/uncinocarpus_reesii/Info.html) // molecular systematics proline-rich antigen (PRA) gene - Johannesson H, Vidal P, Guarro J, Herr RA, Cole GT, Taylor JW, Mol Biol Evol 21:1134-1145, 2004 // systematics/ taxonomy mating studies - Sigler & Carmichael, Mycotaxon 4:462-471, 1976
Compounds:
Cross Reference:
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
MycoBank ID: 325245
Sequences: >UAMH01704_AJ292093_chitin synthase AACACCTGGGGAAAGGAGGCATGGAAGAAGATCGTGGTCTGTGTCGTCAGCGATGGCCGTGCAAAGATCAATCCCAGAACACGGGCGGTTCTGGCCGGTTTGGGGGTGTATCAAGATGGAATTGCCAAGCAGCAAGTCAACGGAAAGGACGTGACTGCTCACATCTATGAATATACAACTCAAATGGGCATGGAGTTGAAAGGCAACCAAGTGCTCCTCAAGCCGCGACGGGGTATGCCCGTTCAAATGCTGTTTTGCTTAAAGGAAAAGAACCAAAAGAAAATCAACTCCCACCGTTGGTTCTTTCAAGCGTTCGGACGTGTCCTGGATCCGAATATTTGCGTCCTTCTTGACGCAGGTACCAAACCA >UAMH01704_AJ292108_pyrG GACTTCTCCTCCGAAACCATCGCCGGCCTCCAATCCCTGTCCCAAAAACACAACTTCCTCATCTTCGAAGACCGAAAGTTCGTCGATATCGGAAACACGGTGCAAAAGCAGTATCATGGCGGTGCATTGCAGATCTCACAATGGGCGCATATCGTCAATGCCACCATGCTTCCCGGCCCAGGGATCATAGACGCGCTGGCACAGGTGGCTTCAGCGCCGGACTTTCCCCATGCGGCGCACAGAGGGCTCTTGATCCTCGCAGAAATGACGTCGAAGGGCAGCCTGGCCACCGGCAAATACACGGAGCTTTCGGTGGAGATGGCGCGGAAATATAGGGGCTTTGTTCTGGGGTTTGTGGCTACGAGATCTCTGGCGGATGTGGACACGGCTGCAAAG >UAMH01704_AJ291973_tcrP GATATCTACACGTAAGTGATCTGATCCGAGTCATGCAGTGGTCACAACGATGGCTAACCGTTGAAATAGCGAATTCTCCGCTCTGAAGAGTATTGTCATGGCATCGCCAAATGATGTCGTCAAAATGCCAATCAACGAGCCCGCGAAGGGAAAGAAGCAATCCCAGATCGAGGAATATGTCGACTTCTACAGCGGTGCTGGTGTGCAACACATTGCGCTCCGAACTGACAACATCATCAACGCGATCACCAACCTCAGGGCTCGCGGTGTGGAGTTCATCAAGGTTCCCAGCACCTACTATGATGACATCAAGCTTCGCCTCAAGAAACAGGGCTTAGTCCTCAACGAAGATCTTGAAACCTTGCAGAGCCTAGATATCCTCATCGACTTCGATGAGAACGGCTATCTCTTGCAGCTTTTCACAAAGGTATGCGCCCTGGTCGTGTGACTTCGATTCTGATATAACTCCTGCTAACGGTATCCGCAGCACCTCATGGACCGGCCAACC

IMAGES:

LOCATION: