<< back to search

Search Details

add to cart



UAMH Number:6337
Species Name: Papiliotrema flavescens
Type:
Synonyms: Cryptococcus flavescens / Cryptococcus laurentii var. flavescens / Rhodotorula flavescens / Torula flavescens / Torulopsis flavescens
Taxonomy: FUNGI Basidiomycota, Tremellomycetes, Tremellales, Tremellaceae
Strain History: Schulz, J. (2382-11) -> UAMH
Substrate: shipping door, brewery
Location: CANADA Alberta, Calgary (GEO: 51.057,-114.034)
Isolator: L. Sigler
Isolation Date: 1989-02-06
Date Received: 1989-02-14
Characters: CULTURE CONDITIONS API profile # 2773673 // MOLECULAR SYSTEMATICS Concordia Univ Fungal Genomics Project - https://fungalgenomics.concordia.ca/feadb/search.php // MOLECULAR SYSTEMATICS Concordia Univ Fungal Genomics Project - https://fungalgenomics.concordia.ca/fungi/Clau.php // MOLECULAR SYSTEMATICS Concordia Univ Fungal Genomics Project - https://fungalgenomics.concordia.ca/home/index.php // MOLECULAR SYSTEMATICS identification of fungal enzymes for industrial and environmental applications // MOLECULAR SYSTEMATICS ITS and D1D2 sequence match to match to Cryptococcus flavescens T CBS 942 (AB035042/AB035046). - fide Dr. Alvaro Fonseca, Portuguese Yeast Culture Collection
Compounds:
Cross Reference: PYCC 6021
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 813289
Sequences: >UAMH06337_ITS AAGGATCATTATTGATTGGTCGAAAGACCTTATCAGATTCTACCACCTCTGTGAACCGTTGACCTCCGGGTTAATAATCAAACATCAGTGTAACGAACGTAAGAGTATCTTAATTAAACAAAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGGCTTGGACTTGGGTGTCTGCCAGCAATGGCTCACCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGTGATGACTGCTCAAAACCTGCCATCGCGCACCTTTTGACTTTGACCTGAAATCAGGTAGGGCTACCCGCTGAACTTAA >UAMH06337_HQ681900_LSU AAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGGACTGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGGAAGGTGGCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC >UAMH06337_LSU AAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAGTCGTTTTCCGTGCCGGACTGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCAGTCGGGTCAACATCAGTTTTGTTCGGTGGATAAGGGCAGTTGGAAGGTGGCACCCTCGGGTGTGTTATAGCCAGCTGTCGCATACATCGGATGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC >UAMH06337_HQ681901_SSU-LSU AAGGATCATTATTGATTGGTCGAAAGACCTTATCAGATTCTACCACCTCTGTGAACCGTTGACCTCCGGGTTAATAATCAAACATCAGTGTAACGAACGTAAGAGTATCTTAATTAAACAAAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTCAGTGTCATGAAATCTCAATCTAATATGTTTTCTGAACATGTTAGGCTTGGACTTGGGTGTCTGCCAGCAATGGCTCACCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGTGATGACTGCTCAAAACCTGCCATCGCGCACCTTTTGACTTTGACCTGAAATCAGGTAGGGCTACCCGCTGAACTTAA

IMAGES:

There are no images in this gallery.