<< back to search

Search Details

add to cart



UAMH Number:6695
Species Name: Wilcoxina mikolae var. tetraspora
Type: Wilcoxina mikolae v. tetraspora
Synonyms:
Taxonomy: FUNGI Ascomycota, Pezizomycetes, Pezizales, Pyronemataceae
Strain History: C.S. Yang (CSY 57) -> Egger, K. (A01235) -> UAMH
Substrate: forest soil nr Pinus resinosa seedlings in greenhouse
Location: USA New York, Syracuse, State University of New York (SUNY) (GEO: 43.04,-76.139)
Isolator: C.S. Yang (CSY 57)
Isolation Date: 1984-07-14
Date Received: 1990-11-01
Characters: MOLECULAR SYSTEMATICS E-strain mycorrhizal fungi - Egger, Can. J. Bot. 74:773-779, 1996 // MYCORRHIZAE DNA polymorphisms - Egger et al., Mycol. Res. 95:866-872, 1991 // MYCORRHIZAE E-strain - Egger & Fortin, Can. J. Bot. 68:1482-1488, 1990 // MYCORRHIZAE ectendomycorrhizae - Yang & Korf, Mycotaxon 23:457-481, 1985 (Click for publications citing UAMH 6695)
Compounds:
Cross Reference: ATCC 60191 // CBS 423.85 // CSY 57 // CUP 60628 // DAOM 213627
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 117510
Sequences:

>UAMH06695_U38626_SSU GATCGGCAACGATCACCACCGGATGGAAAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGAAATTGGTTATACATTTCATGTATCAACTGTTTAAACCCATTCTGTGTACCTTGCCTGTTGCTTCCATGGAGCCTGACTTTGGTCACTCTTGTGATGTAAATCCCAAGGGAGTCCCCATGGAAGGTCATCAATAAAACTCATGTATCCAATTTCTTCTGTCTGAACTG


IMAGES:

There are no images in this gallery.