| UAMH Number: | 6848 |
|---|---|
| Species Name: | Wilcoxina rehmii |
| Type: | |
| Synonyms: | |
| Taxonomy: | FUNGI Ascomycota, Pezizomycetes, Pezizales, Pyronemataceae |
| Strain History: | R.M. Danielson (RMD 2338) -> Egger, K. (A01436) -> UAMH |
| Substrate: | roots Pinus banksiana, greenhouse from Canstar, fine overburden | Location: | CANADA Alberta, Fort McMurray (GEO: 56.726,-111.38) |
| Isolator: | R.M. Danielson (RMD 2338) |
| Isolation Date: | 1982 |
| Date Received: | 1991-06-12 |
| Characters: | MOLECULAR SYSTEMATICS E-strain mycorrhizal fungi - Egger, Can. J. Bot. 74:773-779, 1996 // MYCORRHIZAE DNA polymorphisms - Egger et al., Mycol. Res. 95:866-872, 1991 // MYCORRHIZAE E-strain - Egger & Fortin, Can. J. Bot. 68:1482-1488, 1990 // PIGMENT brown - (Click for publications citing UAMH 6848) |
| Compounds: | |
| Cross Reference: | DAOM 213619 // RMD 2338 |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: no | Animal: no | Plant: no |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 104862 |
| Sequences: | >UAMH06848_U38634_SSU GATCGGCAACGATCACCACCGGATGGAAAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGTATATAGTTATACATTCTGTGTATCGACTAAATATACCCATTCTGAGTACCTTGCCTGTTGCTTCCATGGAGCCTGACACATGTCACTCTGGGGATTTACATCCCGAGGGAGCCTCCGTGGAAGGTAATCAAGTAACTCTTGAATCCAATGTCATCTGTCTGATAATG |
There are no images in this gallery.