| UAMH Number: | 7659 |
|---|---|
| Species Name: | Cutaneotrichosporon cutaneum |
| Type: | Trichosporon cutaneum |
| Synonyms: | Basidiotrichosporon cutaneum / Candida balzeri / Geotrichoides balzeri / Geotrichoides paludosus / Geotrichum cutaneum / Geotrichum hirtum / Monilia balzeri / Monilia cutanea / Mycoderma cutaneum / Mycotorula mucinosa / Neogeotrichum pulmoneum / Oidium cutaneum / Oidium pulmoneum / Oospora cutanea / Oospora granulosa / Parendomyces balzeri / Proteomyces balzeri / Proteomyces cutaneus / Saccharomyces balzeri / Trichosporon aneurinolyticum / Trichosporon balzeri / Trichosporon cutaneum / Trichosporon cutaneum var. cutaneum / Trichosporon equinum / Trichosporon granulosum / Trichosporon minus / Trichosporon pardi / Trichosporum balzeri / Trichosporum cutaneum |
| Taxonomy: | FUNGI Basidiomycota, Tremellomycetes, Trichosporonales, Trichosporonaceae |
| Strain History: | M. Langeron -> CBS 2466 -> UAMH |
| Substrate: | Location: | UNKNOWN (GEO: ?,?) |
| Isolator: | M. Langeron |
| Isolation Date: | |
| Date Received: | 1994-10-06 |
| Characters: | MOLECULAR SYSTEMATICS systematics of Trichosporon and related taxa - Middelhoven, Scorzetti & Fell, Int. J. Syst. Evol. Microbiol. 54:975-986, 2004 // MOLECULAR SYSTEMATICS Whole genome sequence available - (Click for publications citing UAMH 7659) |
| Compounds: | |
| Cross Reference: | ALKO 1543 // ATCC 28592 // BCRC 21675 // CBS 2466 // CCRC 21675 // CDBB 735 // DBVPG 6973 // DSM 27285 // FMJ 15013 // IFO 1190 // IFO 1198 // IGC 3462 // IHEM 19492 // JCM 1462 // KCTC 7251 // MUCL 14471 // MUCL 30014 // MUCL 30308 // NBIMCC 3361 // NBRC 1198 // NCAIM Y 01325 // NCAIM Y.01325 // NCYC 444 // NRRL Y-1490 // NRRY-1490 // PYCC 3462 // VTT C-74033 |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: yes | Animal: yes | Plant: no |
| Biosafety Risk Group: | RG2 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) and a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 813398 |
| Sequences: | >UAMH07659_AF444325_SSU-LSU TCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTCTGAGCGTTAACTACATCCATCTACACCTGTGAACTGTTGATTGACTTCGGTCAATTGATTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGATTGGATTTGGGCGCTGCCAGTAGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTTAACTTGTCTTATCTGGCGTAATAAGTTTCGCTGGTGTTGACTTGAGAAGTGCGCTTCTAATCGTCCTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA |
There are no images in this gallery.