<< back to search

Search Details

add to cart



UAMH Number:10744
Species Name: Candida subhashii
Type: Candida subhashii
Synonyms:
Taxonomy: FUNGI Ascomycota, Saccharomycetes, Saccharomycetales, Debaryomycetaceae
Strain History: Rennie, R. (MY 6551) -> UAMH
Substrate: peritoneal dialysis fluid, male 69 yr
Location: CANADA Ontario, Toronto (GEO: 43.653,-79.383)
Isolator:
Isolation Date:
Date Received: 2006-10-19
Characters: HUMAN/ ANIMAL PATHOGEN peritonitis in patient on CAPD - Adam H, Groenewald M, Mohan M, Richardson S, et al, Med Mycol 2008 // MOLECULAR SYSTEMATICS BLAST match no sequence match with ITS & D1D2 sequences - fide UAMH // MOLECULAR SYSTEMATICS mitochondrial genome features - Fricova D, Valach M, Farkas Z, Pfeiffer I, Kucsera J, Tomaska, L, Nosek J, Microbiology 156:2153-2163, 2010
Compounds:
Cross Reference: CBS 10753 // MY 6551 // Mycobank MB 512099 // OMH FR 392 // Treebase SN3981
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 512099
Sequences: >UAMH10744_NR_073356_ITS GAAGGGGGCAACCTCATCTTGGGACTGAAAAGCTGGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTTAGTCTGCGCTTAGGTGCGCGATTTCACACAGTGTTTTCTTTGAAGAACTTTCTCCAGCGGGACGCAAGTCACGCTGGGGGTATACTCAATATAACTTTTTAAAAAATTGTCAAAACAAACTAATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCTTGGGTTTGGTATTGAGTGATACTCTTAGTCAGACTAAGCGTTTGCTTGAAATGTATCGGCGTGGTGGTGGAGCAGCTACCGACGAATTACAATGTATTAGGTTCTACCAAGTCGTTGTATCTTCCAAGGAAAACTTCCCACATGGCCCCGCCTAACAAATCACCAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTATTCTACGTCCGAGTTGTAATTTGAAGAA >UAMH10744_EU836708_LSU AGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTATTCTACGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGGGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGTATGTCTTGCTCTCGGGCGGGGCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGGATGGTAGGACAATCGCGGAGAAATGTGGCACCACCTCGGTGGTGTGTTATAGTCTTTGTGGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTTTGACTAGGATGTTGGCATAATGATCTTAAACCGCCCGTCTTGAAACACGGACCAA >UAMH10744_LSU GGCTTCTTCACTGACCTCCACGCCTGCCTACTCGTCAGGGCATCATTATCAACCCTGACGGTGAAGTATAAGTAACACGCTTGAGCGCCATCCATTTTCAGGGCTAGTTCATTCGGCCGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCGGCTGTCTAGATGAACTAACACCTTTTGTGGTGTCTGATGAGCGTGTATTCCGGCACTTTAACTTCACGTTCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTAAAAGCTCTTCATTCATATGTCCACGTTCAATTAAGCAACAAGGACTTCTTACATATTTAAAGTTTGAGAATAAGTTAAGGTCATTTCAACCCCAAGACTTCTAATCATTCGCTTTACCTCATAAAACTGATACGAGCTTCTGCTATCCTGAGGGAAACTTCGGCAGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAATTCGACGATCGATTTGCACGTCAGAACCGCTACGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCACCATCTTTCGGGTCCCAACAGCTATGCTCTTACTCAAATCCATCCGAAGACATCAGGATCGGTCGATGATGCACCCAGAAGGGCCCTCACCTACGTTCACTTTCATTCCGCGTACGGGTTTAACACCCAAACACTCGCATAGACGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGCGGTTTAAGATCATTATGCCAACATCCTAGTCAAAAAGACGCAGTCCTCGGTCTAGACAGGCAGTATCCACAAAGACTATAACACACCACCGAGGTGGTGCCACATTTCTCCGCGATTGTCCTACCATCCAAACCGATGCTGGCCCAGTAAACTGCAGAGGCCCCGCCCGAGAGCAAGACATACAAAATACCAAGTCTGATCTCAAACCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCGAAGGAACTTTACATGGAATTGGGCATCTCATCGCACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACATAGACAAGAGCCAACCCCAAAGTTACCTTCTTCAAATTACAACTCGGACGTAGAATACGCCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGCTACTAA >UAMH10744_EU836707_SSU-LSU GAAGGGGGCAACCTCATCTTGGGACTGAAAAGCTGGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTTAGTCTGCGCTTAGGTGCGCGATTTCACACAGTGTTTTCTTTGAAGAACTTTCTCCAGCGGGACGCAAGTCACGCTGGGGGTATACTCAATATAACTTTTTAAAAAATTGTCAAAACAAACTAATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCTTGGGTTTGGTATTGAGTGATACTCTTAGTCAGACTAAGCGTTTGCTTGAAATGTATCGGCGTGGTGGTGGAGCAGCTACCGACGAATTACAATGTATTAGGTTCTACCAAGTCGTTGTATCTTCCAAGGAAAACTTCCCACATGGCCCCGCCTAACAAATCACCAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTATTCTACGTCCGAGTTGTAATTTGAAGAA

IMAGES: