UofT DLSPH Webmail Portal LIMS
<< back to search

UAMH 10948 — Aspergillus spinulosporus

add to cart

UAMH Number:10948
Species Name: Aspergillus spinulosporus
Type:
Synonyms: Aspergillus delacroixii / Aspergillus delacroxii / Aspergillus nidulans var. echinulatus / Emericella echinulata / Emericella nidulans var. echinulatashow more
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Eurotiales, Aspergillaceae
Strain History: Iwen, P. (UNMC 083008) -> UAMH
Substrate: left occipital brain biopsy, female 21 yr, who had a small bowel transplant 10 yr prior; histopathology + for Aspergillus-like hyphae
Location: USA Nebraska, Omaha, University of Nebraska Medical Center (GEO: 41.255,-95.976)
Isolator:
Isolation Date: 2008-08-01
Date Received: 2008-09-29
Characters: CULTURE CONDITIONS heavy ascomata on PDA // HUMAN/ ANIMAL PATHOGEN cerebral aspergillosis in a small bowel transplant patient // MOLECULAR SYSTEMATICS calmodulin sequence has 99% identity to 5 strains of E. echinulata in the GenBank - fide P. Iwen (Click for publications citing UAMH 10948)
Compounds:
Cross Reference: NRRL 58599 // UNMC 083008
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) and a CFIA Written Authorization for transfer (http://www.inspection.gc.ca/plants/plant-pests-invasive-species/directives/date/d-12-03/eng/1432656209220/1432751554580#app2) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 816282
NCBI Taxonomy ID: 1810908
GBIF Taxon Key:
Sequences:

>UAMH10948_UAMH_CAM CCGAGTACCAACGGAGGCCTTTTCCCTGTTTGTAAGTGCCATTGGTTGATATTATGTCAGTTTCGAGTTATATTGAAAGTATACTAATATATTCCGCGCTTAACAGGACAAGGATGGCGATGGTTAGTGCATTTGTCCCCCCAGAACTGATCGCATTCGCCCAGCGTCGGTGTTGTAGTTCTATATAAACCGATTCTGATAAACGGCGATAGGCCAGATTACCACTAAGGAGCTTGGCACTGTCATGCGCTCGCTCGGTCAGAACCCTTCAGAGTCTGAACTTCAGGACATGATCAACGAAGTTGATGCCGACAACAACGGCACCATTGACTTCCCAGGTCCGTGATCTCCCAACCTACTTCGCACAGCCAGTTAGAAACTGTACTAATTCCTAAACAGAGTTCCTTACCATGATGGCCAGAAAAATGAAGGACACCGATTCCGAGGAGGAAATTCGGGAGGCGTTCAGGGTGTTCGACCGTGACAACTGTGGTTTCCTCTCCTCTGCTGATCTGCGCCACGTTATGACCTCTATCGG

Images