<< back to search

Search Details

add to cart



UAMH Number:11150
Species Name: Grosmannia clavigera
Type:
Substrate: mountain pine beetle (Dendroctonus ponderosae) gallery in Pinus contorta (Lodgepole pine)
Location: Canada: British Columbia, Kamloops
Isolator: (C) S. Lee
Isolation Date: 2003
Characters: biodiversity, mountain pine beetle genomics project // molecular systematics, expressed sequence tags from the blue-stain fungus, Grosmannia clavigera, a mountain pine beetle-associated pathogen, DiGuistini S, Ralph SG, Lim YW, Holt R, Jones S, Bohlmann J, Breuil C, FEMS Microbiol Lett 267(2): 151-158, 2007 // molecular systematics, expressed sequence tags from the blue-stain fungus, Grosmannia clavigera, a mountain pine beetle-associated pathogen, Hesse-Orce U, DiGuistini S, Keeling CI, Wang Y, Li M, Henderson H, Docking TR, Liao NY, Robertson G, et al, BMC Genomics. 11:536, 2010 // molecular systematics, genome and transcriptome analyses , DiGuistini AS, Wang Y, Liao NY, Taylor G et al, PNAS 108:2504-2509, 2011 // molecular systematics, genome and transcriptome analyses , Haridas S, Wang Y, Lim L, Massoumi Alamouti S, Jackman S, Docking R, Robertson G, Birol I, Bohlmann J, Breuil C, BMC Genomics 2013, 14:373. // molecular systematics, genome sequence, Diguistini S, Liao NY, Platt D, Robertson G, Seidel M, Chan SK, Docking TR, Birol I, Holt RA, Hirst M, et al, Genome Biol. 10(9):R94, 2009 // molecular systematics, genome sequence, http://genomebiology.com/2009/10/9/R94 // molecular systematics, identification and phylogenetic classification of cytochromes P450, Lah L, Haridas S, Bohlmann J, Breuil C, Fungal Genet Biol 50:72-81, 2013 // molecular systematics, identification by padlock probes, Tsui CK, Wang B, Khadempour L, Alamouti SM, Bohlmann J, Murray BW, Hamelin RC, J Microbiol Methods. 83(1):26-33, 2010 // molecular systematics, National Center for Biotechnology Information Genome Project 39847 // molecular systematics, target specific PCR primers, Khadempour L, Massoumi Alamouti S, Hamelin R, Bohlmann J, Breuil C, Fungal Biol 114(10):825-833, 2010
Compounds:
Cross Reference: Genbank ACXQ00000000 // Genbank ACXQ01001232 [obs // Genbank ACYC01000000 // GenBank AY263195 beta-tub // Genbank AY544597 actin // Genbank AY544615 ITS2 // Genbank AY544638 EF1alpha // GenBank dbEST GT571599-GT // GenBank dbEST GT610085-GT // NCBI Taxonomy ID: 655863 // SLKW 1407 [original assig
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
MycoBank ID: 500813
Sequences: >UAMH11150_HQ633079 CAGGAGATGACCATGTCCTGCTTCGAGCCGAACAACCAGATGGTCAAGTGCGACCCCCGCCACGGAAAGTACATGGCCACCTGTCTGCTGTACCGCGGTGATGTCGTGCCGAAGGACGCCCACGCTGCCGTCGCTACGCTCAAGACCAAGCGCACCATCCAGTTTGTCGACTGGTGCCCGACCGGCTTCAAGCTCGGTATCTGCTTCCAGCCGCCCGAGATGGTCCCCAACGGCGACCTGGCCAAGGTCAACCGCGCAGTGTACGTGGATAGCATCTCTTCCCTTTCTCTCCTGTATGTGTATGTTCTAACAAGCCTAGGTGCATGCTTTCCAACACCACTGCGATCGCCGAGGCCTGGTCCGCACTGTCGGCCAAGTTCGACCTCATGTACTCCAAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGGTATGGAGGAGGGCGAGTTCTCCGAGGCCCGCGAGGACCTGGCTGCGCTCGAGCGCGATTACGAGGAGGTCGCCACGGATTCCCTGGAGGGTGAGGAGGGCACCGAGGCCGAGTACTAGATTCGAGTCTGGCATCGAGCCTTTACCACTACTACAGTGCTTGTAATTGCAGTGAGAGACAGACTGGCTTTATCGAATTCCCCCCTGAACGT >UAMH11150_HQ633149 TCGGGTGGCCACATCACGATTGATGGCATCGACATATCGACCATCGGGCTGAGTGACCTGCGATCGCGCTTGGCCATCATCCCACAGGACCCAACGCTGTTCCGGGGCACAGTTCGGAGCAATCTTGACCCGTTCAACGAGCACACCGATCTGGAGCTCTGGGAGGCACTTCGTCAGGCCGATCTTGTCTCAGACGAAGCGGCGGAGCAGGCAACAGCAGATATCAACGAGCCTGGAAGTGGTGGCGAGACGCGAGACGCGGGGCGCATCCAGCTAGACAGCGTGGTCGAGGAGGACGGCCTGAACTTCTCGCTCGGCCAGCGGCAACTGATGGCTTTGGGCCGTGCGCTGGTGCGCGGAAGTCAGATTATTGTGTGTGACGAGGCGACATCGTCGGTCGACATGGAGACAGACGACAAGATCCAGCAGACGATTGCGTCTGGCTTCCGGGGCAAGACGCTGCTCTGCATTGCCCACCGCCTGCGGACAATCGTGGGGTATGATCGCATCTGTGTGATGGACCAGGGTCGCATTGCTGAATTGGACAGC >UAMH11150_HQ633219 AGGCTGCACGAACAGCATGGCTCTGTCGTTCGTCTTGGCCCGAACGTGCTCTCGTTTTCGGATCCGAAAGCCCTACGAACAATATATGGATTGAATAAGGGGTTTATCAAGGTAGCTTGGCCCTACACAACCAACTATGTTGACACCAACACTGACATGAGTGCAGTCAGAATTTTATGTTGTGCAGCAGTCCGTGGTCAAGGGGCACAGCCTCGCCAGCCTGTTCAGCACTACAGACAATAGCTTCCACGCACAGTTCCGGCGATGTGTTAACTCGGCGTTTGCCATGTCGGCCCTGGTGCAGTACGAACCATTCGTGGACAACACGACCAAACTCTTTCTCAAGCAGACGGAGAAGCTATTTGTTGGCAACCCGGCTGGATGCGACTTCACCCGGTGGCTGCAATTCTATGCATTCGACGTGATCGGAGAGATAACGTACAGCAAGCGGCATGGGTTCATCGAGAAGAACGAAGACATAGAGGGGATTGTCGACTACCTGTCTCGGCTATTTCTCTATGTGGCTCCGGTATGTCTGAACGGTTGAGGGCGGGTTCCCAGAAGCGCAGATGCTGACATCAAAACAGATTGGACAGATACCGTTGCTTGACCGGCTACTGCTGAAGAACCCGATCTATCTGAAGCTGTCGCAGTACGGGCTGATTGACTCGACCTTCCCGGTGGCGCGATTTGCACGGGCACGGATGGCCGAACGGCTGCCAGACATTGTAGAGGGCAGCGGGCCAATTCTGCCGACAAAGACAGAGAAGAAGAAGCCGACGGTGGACTTGCTCTCCAAATTTCTGGCGGCCAAGGAGGCGCGGCCGGAGTTCATGAACGACACGCTGGTGCAGACGATGGCGGTGTCGATGGCATTTGCGGGATCGGAGACGACGGCGATCTCGCTGTCGGCGGTGTTCTACTATCTGCTGCGCAACCCGACAGCACTGCAGCGACTGCGTCAGGAGCTGGACGAGGCGGCACGGAGCGGGCTGTTCAGCGATTACGAGACAGGGCTGGTGACATGGCACGAGAGCCAGAAGCTGCCGTATCTGGACGCATGTGTGAAGGAAGCGTTTCGGCTGCACCCGGCACCGGGGCTGCCGATGGAGCGGGTGGTACCTGCGGGAGGCATGGAGATCGCTGGTCATTTTGTCGCGGGCGGCACCATTGTCGGCTGCTCGGCCTGGGTGATGCACCACAACAAGGCCGTGTTTGGCGAGGACACGGACGCGTACCGGCCGGAGCGCTGGCTCGTGGACGAGGCGGTGGCAAGCAGCAGCGCGGACGCGCGGGTGGGCGAAGAGCAGCGGATCAAGGAGATGAACGGCATGATGCTGCAGTTTGGCATGGGCTCGCGGACATGCATTGGCAAGAACATCAGCCTGTTGGAGATCTACAAGGTGGTGCCGAGCTTGCTGCGGCGGTTTGAGATCCAGTTTCTGGACGAGAAGCTGGAGTGGGAGCTGGTCAATGCCTGGTTCGTGAAGCAGAAGAACTTTTGGATCACGTTGGCGATGCGAGATCTGGTGCAGAAGAGTGAGAACGTGTAA >UAMH11150_HQ633289 TGGTTCAACTATTTGGCTTTTGACGTGATCGGCGACCTGGCTTTTGGTGCGCCCTTTGGTATGCTCTCGAGCGGCGCCGATATTGCCGAGGTGCGGGCCTCGGCCGACAGCCCACCGGTGTACGCGTCCGCGATTGAGATTCTGAACCGGCGCGGCGAGGTCTCGGCGGCGATTGGGATTCTGCCGGCCCTGAAGCCGTGGGCCTCCTGGATGCCGGACCCGTTCTTCCGCAACGGGTCCAAGTCTGTCCAGCAGCTGGCCGGGATTGCTATCGCCCGCGTGCGCGAGCGTCTGGAGCGCCAGCCGTATGGCAAGGACCTCGAGAACGGCCGGAAGGATCTGCTGGCCCGTCTGATGGAGGGCCGCGACGACAACGGCGCCCCGCTCGGCCGCGAGGAGCTCACGGCCGAGGCTCTGACCCAGCTGATCGCCGGCAGCGACACCACCTCCAACTCGTCGTGTGCCCTGCTCTTCCACGTCGTCCGCACCGACGGCGGCCGCGTGCTGCGCCGCCTGCAGGCCGAGCTCGATGCCGCTCTGCCGGCCGGCAAGGACGTGCCCACCTTTGACGACGTCCGCAACCTGCCCTATCTCCAGTCCGTCCTCAACGAGACCCTGCGCCACCACTCCACCTCTGGCATCGGTCTGCCGCGCCAGATCCCCGCCGATAGCGCCGGCATCACCCTGCACGGTCACTACTTCCCGCCCGGC >UAMH11150_HQ633359 TCGTTCTCCGTGTGGTTACCGCGGTGGTGGCGAACGGGCGCGCGCTTCGACTCGGTCGACTGGGCACGCAGGTGCGCCTGGTGGACGCGCGGGTCGATGACGTTTCGTGAGGCTTACGAGCGCACTGGGCGCATCCTCAACGTGACGTGCGTGCCGGCAGACCCGCACTCGCCGACGATCCTGTGCAACTATCGCACCTCGCCCGACTGCGTCATCTGGTCGGCCGTGCTGGCGTCAGCTGCTGTGCCGGGCATCCTCAACCCCGTGGTGCTGATGATGAAGACGCCGGTGCCGGGAGAAGCTGGTGGCAAAAATTACCGGCTGGTGCCGTATTCGTTTGGCCACAAGTGGAAGGATGGCAGTCTGCGGACAGACATCCCGCTCAAGGCGCTTAACCTGCACTTCAACGTCAACTTCACTGTCGTCAGCCAGGTAAACCCGCACGTCAATCTCTTCTTCTTCAGCAGCCGCGGGTCCGTTGGTCAGCCGGTGACTCACCGCAAGGGCCGCGGCTGGCGTGGCGGTTACTTGGGCTCGGCCTCTGAGGAATACTTCAAGCAAGACCTGCGCAAGTGGCTCAAACTGCTGCGTAACTTGGAGTTACTGCCCCGGCCGCTGGGCCAGGACTGGTCGCAGTTGTGGCTGCAGCCCTTCAGCGGCACCGTGACCATCTGGCCCAAGAGCGTGCTCTCCGACTTTGTCCATATCTTGTCCGACCCCAACCCGACCCGGCTGGCTCACATGCTGCACGAGGGCTGTCAGTCCGCCTTCCCACCGCTGAACTTTGTGGCCAATCGCCTGCGTGTCGAGCGTATGGTCGAGCGCGGTCGGCTTGCGTCACGCTTGCACTATGGTAGCGATGGTGGCGTTGGCGGTAGTGGTGATAGTTTCTGGTCCGGCCATCACGCCGGTGGTGGTGGCAACATTGACTCCATAGCCAGCGAAGACGAGTTTCATGTCTTGCTGGCTGGTGAGGGCCCGGCTGCCAGGCGCTTCGGTAGCCGCCGTGGTCGGGCCGGTTTGGGTCTCGCCAGCACGACGGCCACGTCAGACGAAAACATGTCCCTCTCATCATCGTCTTCATCGGACGTTGAAGCTGCAGCAGCTCGACCCAGCGTCGGCGAC >UAMH11150_HQ633429 GTAAGCCCAATGTCTCGCCGCGCTCCGTCGTCCTTCCAACGCTGACTCTGTCGACCCTCTTTTTAGCAAAGCTGCGCCAGCAAGTACCTCGCCGGCGGCATCGGCAACTGCGGCACCGATCCCAAGTGCATCTGCGAAGACTCGGATTTTATCAGCGGCATCGCCTGCTGTCTGGCTGAGCCCGGTGGCTGCGACACGGCCGATCAGTCCTCGGCCGTCGCCTACGCCTCGCAAATCTGCGCCGCCCAGGGCGTCACCGTCCCTTCGGCCGTCAGCTGCACGTCCTCCCTTTCCAGCTCCGGCACCGCTGCTTCGGCTGCTACTGCTACCGCCACCGTCTCCTCCAGCACCGCTGCGACCACCGCCGCCACCGTCGCGTCCACCAGCGCAGCCACCACCGGTGCCAAGACCTCGACCAGCTCGACGGCCAAGTCGGCCAGCTCCACCAAGTCGGCCACTGCCTCGACCGCTTCGGTTGCCACCACCGCGGCCAGCTCGGCCAACTGGGCACCGCAGCAGTCGGCCGCCCTGGGCGGCGTCATCGGCGGTCTCGCCGCCGCTCTAGCCCTGCTGTAAGCTGGTGTGGAGTCTGGAGAGACAGGGCAGCATTAGTTGCGGGGTCAACGGCTATTAGGTCGGCCTTGCCGCTGAACCGTGTGCTGGGACGGTCTGTGG >UAMH11150_HQ633499 TCGCTGAGCTGCTTCCACCAGGCGGCCCAGACCTTTAACTGCGATCCCCATGACATTTCCTGTCGCTGCTCCAAGGAAGTCCAGATGACAGCCACCATGGAACGCTGTCTGCAGCGATCCTGCTCGGACCACCACAAAGCGAGTGCGTGACCCTACTGCTGCCGCCTGCTGCTAATCCATCTGCTGACATAAGCACAATTTCTCAGTCACCGAGAATCTCTCCCACGAGATCTGCAACATCCAGCTGCAGAACAACATGCTGTACAAGAAGTCGGCCGAAGCCGCCCCAGCGCCAGCTCCAGCTCCGGTTCCGGCAATCCCAGATGTCCCGGTCGTGCCGGATTTTGCTCGTCGGGCGCCTGAGGCTGTGGCGTCGTTCCCGGTCATCGCCTCGAGCATCCCGGCATCGTCCATCGCCCCCTTTGCGACCAGCACGGCCACACCGGCGCCCGTCGTGACCGCCGGTGCCGCCGCAGTTGCCACGCCCGTTGCC >UAMH11150_HQ633569 CTGGGACTGGGATGTCTAGACTCCTGACGGTTGTCTGACAATTCGCTGATCTTCTAGGGCATGCGCATGCCGGGATGGTATGACATTGTAGGTTGATCTAGGTCCTGTTGACGTTGACCTCTCCTCCTTCTCTCCCCCCTCTCACATCGCCCAGGTTTCCTTCGACAGCCCGGGCACCAGCCTGCGCGACAACGAGGACGAGGCCGGCCTCGTCGCCTCACGCGCCTACTTCCACCAGCTGGTCCAGCAGGAGATCGATGCCGGTGTGCCGGCCGAACGCATCGTCCTCGGCGGCTTCTCGCAGGGCGGCGCCATGGCCATCTTTGCCGGCATCACGAACCCGCGGCGGCTGGCCGGGATCGTGGCCATGTCCACGTACCTGGTGCTCTCGCAAAAGATCGAGTCGAAGTACCTTCCTAGCCCCAACGCCAACGCCTACACGCCCGTCCTCTGGTGCCACGGCACTGCCGACCCGGTCCTGCCCTACAAGATGGGTGAGCTGTCACGTGACGCCCTGCGCCGCATGGGCTATCCTGTCGAGTGGAAGTCGTATCCCGTGAGTGTGCGCC >UAMH11150_HQ633639 ACTAGCGAGCGCATGCTGACTAATCTGGCGGTCGAGTACGAGCGTCTGGCGGACCCGCGGCTGCCGGCATGCAGCCGCAAGGCCGGCCACCTGCTCGAGACCTGCTGCACGATCATGGACATGAAGGGCGTGGGCATCTCCAAGGCACCGCAGGTGTACGGTTACATCCGCCAGGCCTCGGGCCTGTCGCAGAACTACTATCCCGAGCGCCTGGGCCGCTTCTACCTCATCAACGCGCCCTGGGGCTTCTCGGGCGTCTGGTCCATGATCAAGGGCTGGCTCGACCCCGTCACCGTCGCCAAGATCCACATCCTCGGCAGCAGCTACCAGAAGGAGCTGTTCGAGCAGGTCCCGCCCGAGAACCTGCCCAAGCGCTTCGGCGGCCAGTGCGAGTGCCCCGGCGGCTGCGAGCTCTCCGACATGGGCCCCTGGCACGAGGACGAGTGGTTCCGTCCAGCCAAGTGGGCTCGGGAAGCCACTGCGGCTGCCGACAAGTCGGCAGAGGCTGGTGCCGGTGCTGTGGAGGGCGTCACACTTGAGGTCCCCGGTGATGCCGTCGGCGAGGCCACT >UAMH11150_HQ633709 TTCTATTTGCTGCTGCCACCACAGAAGCTCACAAGCCAGATCTACTTTACCGACGTCATGCCCAAGACAGCCACCGGCAAGATTCAGAGACGGATCGTTGCCGAAACCATGCAGAAGCAGGACGGCAAGGCGAAGTTGTAGAGTGTTGTTGTTGTAAGGATAGAGCTGTATTATCGGAAAGGGACGTGTGGTATGAATATAGTGTTTATGTCAGGGAGAAGCTCGAATCTTATGCAGACGCACAATGTAGACGGGCCTGCTTAGTAAATTATCGTAACGTTTTATAGCCTTGCCGAACAGCCGAATGCGATGAAATCAAACGAACATTAAAACAAGCATCCGTGGGCCGGCCGACCTCCCCCTTGCCTCTAGATAATTTTGTACATGCAGACTCTGTCCACTGTGTCTCTGCCATGAGCCTGTATCCGCTGCCTGCGTCCTCTCCTCATGAATCGCTCTCCCCTAGTTCCTGCTCTCTCTCCTCTCTCTCGCCCCTCGGCTCCCGTCTCAAAAAAGGCAGTGGTCAACGGCGACATGGCGCGAGACAGGGCTGCTGCAGAGCGTGCCGCAGCCGGAAGTCGACGACGCCTCTGCTCTCCGGCGGGCTGCTTCCTAGTAACCCTCGGCGCCCGGCGCTTTCTCGTCCTTGCGCAGGCTGACGAGGAGCTCACGGAAGCGCTCCTTG >UAMH11150_HQ633917 GAGCTCACGTCGCTGATCCAAAAGCGCTTCAAGTTCCCCGAGAACAGCGTGTCCCTGTACGCCGCCAAGGTCCAGAACCGCGGTCTGTCGGCCGTGGCCCAGTGCGAGTCGCTGCGGTACAAGCTGCTGAACGGCCTGGCCGTCCGCCGTGCCTGCTACGGTGTCCTGCGCTTCATCATGGAGAGCGGCGCCAAGGGCTGCGAAGTTGTCGTGTCCGGCAAGCTCCGTGCCGCCCGTGCCAAGTCCATGAAGTTCACCGACGGCTTCATGATCCACTCCGGCCAGCCGGCCAAGGACTTTATCGACAGTGCCACCCGTCACGTGCTGCTGCGCCAGGGTGTTCTGGGCATCAAGGTCAAGATCATGCGCGGCTCCGACCCTGATGGCAAGGCCGGCCCGCAGAAGACCCTGCCGGATGCCGTCACCATCATCGAGCCCAAGGAGGAGCAGCCGGTGACCCAGCCGATCAGCCAGGACTACGGCGCCAAGGCCGCACAGCAGGCCGCTGCCGCCGAGGCCCAGCGCGCCCTCGAGGCCCAGCAGGCCGCAGCCGCAGAGGAGGAGGCCGCGCCCGCTGAGCAATAGGATGCTCGACGTGCAGCTGGTGGCGACGGTGCCGGTCTCTTGGATGGCGCTGGACCTGTCGCTGGGGAGGCGTTGGGTGGAGCAGCGATGATCGGACTCGGGCCTGTCGGAGTCCAGAACGACGGTTACGGCAGACACGAGCGGACGGCTAGTGCC >UAMH11150_HQ633987 TCGCCGCACCACCCCAAGGCGATAGACCCGATCCAGTCAGCGTCCAACGTGGTGCTGATCGACAACTATGACTCGTTCACGTGGAACGTGTACCAGTACCTAGAGCTGGAGGGCGCATCGGTAACGGTGATCCGCAACGACCAGATCACGCTGGAGCAGCTGATTGCAAAGAAGCCGACACAGCTGGTGGTGAGTCCGGGGCCCGGTCACCCGGCGACCGACTCGGGCATCAGCCGGGACGCAATTCGGCACTTTGCAGGCAAGATCCCGGTGCTGGGCGTCTGCATGGGTCAGCAATGTATCTTCGAGGTGTTTGGTGGTACGGTCAGCTCGGCCGGCGAGATTCTGCACGGCAAGACGTCACCGCTGGTCCATGACGGCCGCGGGGTGTATGCGGGGCTGCCACAGTTGCTGCCGGTCACGCGTTACCACTCGCTGGCGGGCACGCGCGGCACGCTGCCGCCATCGCTCGAGGTCACGTCGTGGATCTCCAAGGCTGACGGCAGCCCGGGCGTGATTATGGGCGTGCGTCACAAGGAATATACGGTGGAGGGTGTGCAGTTTCACCCGGAGAGCATTCTGTCGGTGTCGGGCCGTGGCATGTTCCACAACTTTCTGGTGATGCAAGGCGGCACCTGGGCCGAGAACGAGCAGCTGCAAGCAAAAAACACTACAACGGAAGCCATTGCGGCTGCTGCTTCGGCCAAGACCAACATCCTGCAGCAGATCTTCTCGCGTCAGCGCATCGCAGTAGAGGCGCAGAAGAAGGTGCCGTCGCTGCGGCCCGAGGACCTGCAGGCAGCATACGACTTGGGAGCAGCACCGCCAGCACTGTCGTTTGCAGACCGGCTGCGACAGTCGCCATTTCCGGTGTCGCTGATGGCCGAGATCAAGCGGGCATCGCCATCCAAGGGCGTGTTCGCCATGGACATCCGGGCGCTGGGGATGGAGCCGCTGGTCGAGGTGCAGAACGCGGCCGAGATGGAGCGGGCTGTTGGCCAGCTGGGCGCCAAGGTCATCGGCGTCAACAACCGCAATCTCGAGAGCTTCGAGGTCGACCTGAAGACGACCAGTCGGCTGCGCAGCATGGTGCCGGCCGACACCATTCTCTGCGCCCTCAGCGGCATCAACACGCGTGCCGACGTCGAGGCTAACGAGCGCGACGGTGTCAATGCCGTCCTCGTCGGCGAGTCCATCATGCGTGCTGCCGATCCTGCTCTATTCATCCGTCAGCTCTGCTCAGGCTCAGGTGCGCCGGCTCCTTCTTCCTCTTCTCCTGCTGCTGCACATTCCTTACTCGTCAAGATCTGCGGGACGCGTAGTCCCGAGGCTGCCCTCGAGGCTGCCCGCAGCGGTGCCGACATGGTGGGCATAATCTTTGCCCCCGGCCGCAAGCGCACCGTCTCACACGAATCCGCCTTGGCCATCTCGCGTGCTCTGCACGGCTTTGCCGATTCCGACCCGTCCAGCTCTACGGCCACGGCTGCCAAGACCGCCACTGCCACCGTTACTGCCACCGATTTCTTTAGCCTCGCCCGGAAGACACTCGCCCGCCGGAAGCGGCCCCTCCTAGTAGGCGTGTTCCTGGACCAGCCGCTCGAGGAGGTGCTCGAGAAGCAGCGACTGTATGATCTAGACGTCGTCCAGCTGCACGGCCGCGAGCCCATCGAGTGGGCGCGCTGTATCCCGGTGCCGGTGATGCACAAGTTTCAGCCGGGAGAGCCTGGTCTGGGCGTGCGCGGCTACTACACGGCGCCTCTCCTGGACTCGGGCGCAGGGTCGGGCCAACAGCTGGACACGACGGCCGTGCAGGTCGAGCTGGACCGGGACCCCAGATTGGAGTTTATGCTGGCCGGCGGCTTGGACCCGGACAATGTCAGCGAGGCACTAGGCGCATTCGACCGCGACAGCCGGGCGCGGATTATC >UAMH11150_HQ634056 GTGTGTCCAGATGTGCGACTGGTTTAAGGGACTGTGACCCGCACTTGCTTAGTCATGCATAATACCCGGAAATGCTGAATTCCAAAAAGCGCCAGGACTCCAATGCCATCATCACAGTTCACCAGTTCTCCATTGCAATGGCCACGACGGAGACTCTACTAGAGAGCGACGGCTTCGTGCTCGTGTCGCACGCAGATGCGGTCGAGCTGGGCAGCAGAGAGGCCAGAGAGGCCAGGGAGGTATCCGGCCGGTCGGCCTCACCGCCACGGTATCTCGCCGCAATCTCGGCGTGTGTCGACCAGGCCAGCGCGTCTCTGTGGCCGCTCAATCGGCATATCCACGACCACCCGGAGCTGGCCTTTCACGAATTCGAGGCGCACCGACGGCTGACGGCCTTTTACGAAGGGCGCGCCATCGGCAGCGGCAACCACAGCGCACGCTGGACGGTCACGCGAGAGGCCTATGGTATGCGCACAGCTTGGGTGGCCGTCTACGATAGCGGGCGAGCTGGGCCGGTCGTCTCGTTCAACGTCGAGATGGACGCGCTACCCGGCGTCGGCCACGCCTGCGGCCACAACCTGATTGCCACGGCGTCTGTGGCCGGCAGCCTGGCGACAGCCGAGGTGATGTGGCAGCATCGTCTCGGAGGAAAGATTGTCGTCTTTGGAACCCCGGCCGAAGAGGGTGAGTTCTGTTTGTTATCACGCTGTTCCGTTCTTCGTTTCATCGTGCTCGTCATCCCCACTGTCCGTCTCTAGTTCCGTCTCCACCTTTTCGTTTCCACCGTTAGACTCTTCGTTCACCGTTCCGTTCCACCGTTCTGCTCTTCTTCGCTCATCATTCCGTCTCTTGCTTCACCCCCCTGATTCCCCTCCCCTACTCCGTACTGACCCTTCAGATGGCGGTGGCAAGGTCTGCCTCCTCGAAGCCGGCGCCTACCGTGAGCATGGCGCAGACGTGTCGCTCATCACGCACCCAAGCACGACGACGCCCAGCGCCATGATGCGCACGACAGCCATCACCAACTTCATGGCCTCGTACGAGGGCCGGGCAGCCCATGCGGCCGCGTCGCCGTGGCAGGGTGTCAACGCGCTGGACGCTCTCGTGCAGGCGTACACGGGCCTCTCAATGCTGCGACAGCAGACGGCGCCGGGCGACATCATCCAGGGCCGCATCACCGACGGCGGCGCAGCCACCAACATCATCCACGAGCACGCGGCCGGCGAGTTCGCCGTGCGAGCACCCTCGAAGCGTCGCCTCGCTGAGCTGCGCCAAAAGGTTGACGGTTGCTTCCGTGCTGGTGCCGAGGCTACTGGCGCCCGTTTGACGCTTGATGAACGCGGCGGCTACGCCGATCACATCCCCAACCGGCTGCTGGCCTGCGCGTATTCACGTTACTGGAACGAACTCGTGCGCCAGGACCCTGCCGTCCCGGACGACGAGCACATCCCCGACAATCTCGACGTCGACGACGCCCGTGGAAGGACTCTTGCCAGTACCGATCAGGGCGACGTCAGCTACGCGATGCCCAGCCTCAGCGCCGGCTTCCGCATTCCGTCTATCCCCATCGACGGCAGCAGTCGTCCTGGTGGTGGCCCCCACACTGTCGACTTTGAGCGCGCTGCAGGCACGCGCATCGCCTTTGAACATGCCTTGCGTGCTGGCAAGGGC

IMAGES:

LOCATION: