<< back to search

Search Details

add to cart



UAMH Number:11274
Species Name: Meliniomyces bicolor
Type:
Substrate: ex Piceirhiza bicolorata ectomycorrhizal Pinus sylvestris root tip, in soil core 0-12 cm deep
Location: United Kingdom: Scotland, Aberdeenshire, Aboyne, Glen Tanar semi-natural Scots Pine Forest
Isolator: G.A. Grelet (B1)
Isolation Date: 2006 Fall
Characters: molecular systematics, genome sequence, http://genome.jgi.doe.gov/Melbi2/Melbi2.home.html // mycorrhizae, ericoid mycorrhiza, Grelet GA; Johnson D; Paterson E; Anderson IC, Alexander IJ, New Phytologist 182:359-366, 2009 // mycorrhizae, Piceirhiza bicolorata ectomycorrhiza of pine, Grelet GA, Johnson D, Vrålstad T, Alexander IJ, Anderson IC, New Phytologist 188:210-222, 2010
Compounds:
Cross Reference: GenBank FN179335 ITS // strain E
Biosafety Risk Group: RG1 (check the PHAC Biosecurity Portal for updates)
MycoBank ID: 500246
Sequences: >UAMH11274_FN179335_ITS CATTAAAGAATCGCCCCGTTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGCAGGCCGCCTTTTAGGCGTTGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAATAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCTTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGTCCCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTCTCGCTATAGGGTCCCGGTGGTTGCCTGCCAGAACCCCCCATTTTTTACGGTTGA

IMAGES:

LOCATION: