<< back to search

Search Details

add to cart



UAMH Number:11295
Species Name: Ophidiomyces ophiodiicola
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Onygenaceae
Strain History: McLelland, D. (90022837) -> UAMH
Substrate: superficial biopsy (retained shed/crust) from a lesion adjacent to the cloaca on a broad headed snake (Hoplocephalus bungaroides) with moist dermatitis; sample taken several mo before death; histopathology + for hyphae and arthroconidia
Location: AUSTRALIA South Australia, Adelaide, Adelaide Zoo (GEO: -34.915,138.606)
Isolator:
Isolation Date: 2010-09-01
Date Received: 2010-11-05
Characters: CULTURE CONDITIONS grows better @ 30C than @ 35C - fide UAMH 2011 // CULTURE CONDITIONS produces arthroconidia and aleurioconidia // HUMAN/ ANIMAL PATHOGEN dermatomycosis in a broad headed snake Hoplocephalus bungaroides - McLelland DJ, Johnson L, Reuter R, Proc Wildl Dis Assoc Austral, Tasmania, Australia p 55, 2010 // MOLECULAR SYSTEMATICS ITS1 has 1bp difference with UAMH 6642, 9832, 10079 - fide UAMH 2012 // MOLECULAR SYSTEMATICS phylogeny of Nannizziopsis and reptile pathogens belonging to the CANV complex - Sigler L, Hambleton S, Pare JA, J Clin Microbiol 51:3338-3357, 2013 // MOLECULAR SYSTEMATICS TaqMan real-time PCR for detection of Ophidiomyces ophiodiicola, the agent of snake fungal disease - Bohuski E, Lorch JM, Griffin KM, Blehert DS, BMC Vet Res 11:95, 2015 Apr 15, doi: 10.1186/s12917-015-0407-8
Compounds:
Cross Reference:
Pathogenic Potential: Human: no | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number and a CFIA Written Authorization for transfer prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 550167
Sequences: >UAMH11295_ITS CATTACCGTGTTGGTTGAGCGCCCCTCCCCCCCGGGTCCCCCGGGGGCCGGGCGCCCCTACCTCCACCCGTGTCTACCCCATTCCGTTGCCTCGGCGGGCCCGCCAGCCACCAGCCTGGCGGTCTCCGGGCGTCCCCTCCTGGGGGCGGCCCCGGGGGCCCGCGCCCGCCGGTGGAACCGCGAACGAACTCTGTGAGAAGCCAGTCTGTCTGAGCACGAATGTGAAATCATGTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCC >UAMH11295_KP691514_LSU CCCTCGGGCCCCGAACCTCAGCAGGTCGGCGACGGCGTCCCGGGAGAGACCCCGGGGCGCTTGCCGGCGGATTGCAATGTCACCACGCGCGGGGATAGATCCTCTGCAGACGACTGAAATGACCAAGCGGGTCGTGTAAGCGGTCAAGTAGCCTTGTTGTTACGAGTCGCTGAGCGTCAGCCCGATCCTTGGCTCGATTTGTTGTAAACACCCCCCATCAACGGGGTCTTCGGCAGCGCCGGGGGCTTGAAGGGGGTTCGATGCGTGCACGGGCAAAGAGGCCCCACGGGTCACGGTGGACAGAGAGCGAGCGGGTGGGGGAAGAAAGGTGTGGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCCTCCAGGAGACCTCCCTGGGCCCCCACACCGCCCCCAACACCGCCAGGATGGCGGACCATGCACATTCTCAGAGTGTCGGTCGTCCGTATTTCGTGCACCGAGATGTCGTCGTCGCACGCGGGTGAATTACCCAGTTTTACATTTTCCATACAAAAAGGTGGTCCCGACCCAGTCAGGTCCGGCGACCCAGGGAAAACCCTCGGATCCGCGGAAGACAAGCGCCCGGAGAGTATATGTAGGGAAGGATGGCTTGTCGGATCGGTCACCCAGTGAGTCTTCGGTCTCGCTCAGTGTATGGGCCCGGCAGCATCCGCCCCTGTGGGCAGTGGGTTCTTAGGCGTCTCCGGGCGCCCCGTCACCCGTAGAGGTGTCACATTCGGCGCACGCTTCACCCAACGTTGAGCCTGCTGGCTGCGGTTGGCGCTCCAACGTCCGGGGGTGTGTCGTGCCCGGGGGGATCTCTCCTCCCCGGCACCCGAAGCCCGATGGCCCCCGTGGCCGGTCGGCGCTGTCTGAGGTTTACCTATTGCTGGCCGCTGGCTCGCGATCCGTGAACGCTCCTGGAGGGAGGTGGGCCTTGAGATCCGGGGTCCCGCCCCGTGTTCAGGGCCCTGACCCTTCACCCGGAGGCCCCATGCGGCAGTCGGCGGTGACGCCCCCCTCGGGGGGTCGACCCGGCGTCTCTGCGGCGGACGGTGCCTCAGGGAAATCCAGTGGGGGCATTTGAATGCCTGGGTCCCCCGTGCGGTGCGCCGCACGATCGGGGGCTCCAGGCGGACATCCTCGGGTGTCCCGACCTGCAGACTGCTTCCCGTCCCCCCTGCGTGGGGGGGTGTGGGCGCCCTCCCCGGCTCCGGCCGGCGG >UAMH11295_KF477237_SSU-LSU CATTACCGTGTTGGTTGAGCGCCCCTCCCCCCCGGGTCCCCCGGGGGCCGGGCGCCCCTACCTCCACCCGTGTCTACCCCATTCCGTTGCCTCGGCGGGCCCGCCAGCCACCAGCCTGGCGGTCTCCGGGCGTCCCCTCCTGGGGGCGGCCCCGGGGGCCCGCGCCCGCCGGTGGAACCGCGAACGAACTCTGTGAGAAGCCAGTCTGTCTGAGCACGAATGTGAAATCATGTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCCCTCAAGCCCGGCTTGTGTGTTGGGGGCGCCCACCCCGAAGTCCTCGGGCGCGGGCCCCCCCCCAAATGCAGTGGCGGCACCGAGTTCCTGGTGTCTGAGTGTATGGGAATCTGTTTCTGTCTCGCTCGAAGACCCGATCGGCGCCCGTCGTCAACCCCCCATTCTTTCCGGTTTGACCTCGGATCAGGTAG

IMAGES:

LOCATION: