<< back to search

Search Details

add to cart



UAMH Number:130
Species Name: Blastomyces parvus
Type:
Synonyms: Chrysosporium parvum / Chrysosporium parvum var. parvum / Emmonsia parva / Haplosporangium parvum
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: Emmons, C.W. -> UAMH
Substrate: lungs of a rodent
Location: USA Arizona (GEO: 34.255,-111.626)
Isolator: Emmons
Isolation Date: 1946-11-01
Date Received: 1954-11-27
Characters: MOLECULAR SYSTEMATICS molecular genetic variation among members of the genus Ajellomyces - Peterson & Sigler, J. Clin. Microbiol. 36:2918-2925, 1998 // SYSTEMATICS/ TAXONOMY descriptions & relationships - Carmichael, Mycologia 43:605-624, 1951 // SYSTEMATICS/ TAXONOMY descriptions, relationships & sexual stage of E. crescens - Sigler, J. Med. Vet. Mycol. 34:303-314, 1996 // SYSTEMATICS/ TAXONOMY Whole genome sequence PRJNA252752
Compounds:
Cross Reference: CBS 139881
Pathogenic Potential: Human: yes | Animal: no | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 821085
Sequences: >UAMH00130_AF038333_SSU-LSU AAGGATCATTAACGCGCCGTGGGGGGTCGGATCCCTTAACCGGGAACCCCGGCCCTCTCACCTGGCCACCCTTGTCTATCTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTCTGCTCCCCGGGCTCGTGCCCGCCGAGGACACCACAAGAACCTCTGGTGAACGATTGACGTCTGAAATGATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCATCTCAACTTCAGAGGGAGAGCGGTCTTCGGATCGGTCTCCCCAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGCGGGCGGGCCAGCGTCGGTTTTGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGACC

IMAGES: