<< back to search

Search Details

add to cart



UAMH Number:139
Species Name: Blastomyces silverae
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: W. L. Jellison -> UAMH
Substrate: weasel Mustela
Location: USA Montana, Ravalli County (GEO: 46.017,-114.182)
Isolator:
Isolation Date:
Date Received: 1954-11-29
Characters: HUMAN/ ANIMAL PATHOGEN naturally infected animal from western Montana - Jellison WL, Adiaspiromycosis, Mountain Press 1969 // MOLECULAR SYSTEMATICS molecular genetic variation among members of the genus Ajellomyces - Peterson & Sigler, J. Clin. Microbiol. 36:2918-2925, 1998 // SYSTEMATICS/ TAXONOMY 5-gene based tree placed this strain as sister to B. dermatitidis/ gilchristii - Dukik et al., Mycoses 60(5): 296-309, 2017 // SYSTEMATICS/ TAXONOMY descriptions & relationships - Carmichael, Mycologia 43:605-624, 1951 // SYSTEMATICS/ TAXONOMY descriptions, relationships & sexual stage of E. crescens - Sigler, J. Med. Vet. Mycol. 34:303-314, 1996 // SYSTEMATICS/ TAXONOMY Whole genome sequence PRJNA178178
Compounds:
Cross Reference: CBS 139879 // PRJNA178178
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 821084
Sequences: >UAMH00139_AF038328_SSU-LSU AAGGATCATTAACGCGCCGTGGGGGGCCGGACCCCTAAACCGGGGAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTACTCCCCGGGCTCGTGCCCGCCGAGGACACCACAAGAACCTCTGGTGAATGATTGACGTCTGAGAAAATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCTCTGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCAACCCATTCGAGGGAGGGCGGTCTTCGGACCGGTCTCCCCACCAGGTTGACCTCCGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGCGGGCGGGCCAGCGTCGGTTTTGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGACC

IMAGES: