<< back to search

Search Details

add to cart



UAMH Number:3008
Species Name: Emmonsia crescens
Type: Emmonsia crescens
Synonyms: Ajellomyces crescens
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: Emmons & Jellison -> ATCC 13704 -> UAMH
Substrate: lungs, rodent Arvicola terrestris
Location: NORWAY (GEO: 60.472,8.469)
Isolator: Emmons & Jellison
Isolation Date:
Date Received: 1969-01-01
Characters: HUMAN/ ANIMAL PATHOGEN pulmonary, in rodent - Cano & Taylor, Sabouraudia 12:54-63, 1974 // MOLECULAR SYSTEMATICS molecular genetic variation among members of the genus Ajellomyces - Peterson & Sigler, J. Clin. Microbiol. 36:2918-2925, 1998 // MOLECULAR SYSTEMATICS phylogeny of dimorphic Onygenales - Gueho et al., Mycoses 40:69-81, 1997 // SYSTEMATICS/ TAXONOMY descriptions, relationships & sexual stage of E. crescens - Sigler, J. Med. Vet. Mycol. 34:303-314, 1996 // SYSTEMATICS/ TAXONOMY Whole genome sequence PRJNA178252
Compounds:
Cross Reference: ATCC 13704 // CBS 177.60 // PRJNA178252
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 330349
Sequences: >UAMH03008_LCZI01000286 TCCTCTACTACAAAACTATCTATCTATCTATACTGCCCTCATCATCGATTTTTAATAATTTTGATTCGGCCCCGCCCACCCTTTTTTGGGGGGGATGTTTTTTTATTTATTTTTATTAATTGCGAAAACTGGGGCTCACAAAATAACTATATAGATATAGATATATATATTATAGTTGTTGAACCCAATTTCTTCTTCTCTT >UAMH03008_LCZI01000549 GGTGAGTGAGTAAGCGGAGGCACGAGTAGGAGTTTTATATCCAGGCAGCGGTGACGACAAATCAAAAAGCTGCTGACTACTACTTCGGGGTGGCCCGAGCTCAGCGCGTGTATATCCAGCAACCTACAAGATACAGACACAGAGCTTCAACATCATCAAGACAACAACCACCAGACAACACTTATAATACCCCCCCCCCCCTTCAACCACTTCATCTGCGCTGCTATAGACCCCGCAGATACCCCATTGTGCCATCCTAGAGACTGACTGTTTGTCTATCACATCATGGTAAGCTCTTCCTCCCCGTCCACTTGCTCGTCCTCTCTCTAACCCTCTCCGCTACTCATAGGGCTCCCCCTTCGATATAAGTATACA >UAMH03008_LCZI01000686 ACTCCGCCCGCCAAACGGCCAATTGCCGGCCGTAAACCTGCGCCGCCTACCGCCCCACGAGACAGCGCAGTTAGCATGAACTCGCAGGATTCGTCAGGCGGTAGCGGCCGCGTGACGCCGAATAGTATGAATAATGCTAGTTTTGCGGGGGGGCTTGCGGAAGCCTTGAGGCAAAGGCAAAGCGCGATGAAGCCACAGGATGATGATGATTGGTAGATGCCGGGTGGATATTGGTTCCTTTTCTTTTTTTAAATATTCATTTTTGATAGATATTCTTTTTTTTTTTTCGAATTTATCTTTGTCTTTTATCTTGTTTCCTTTTTTACCCCGTTGTGTTGCTGTTAATATCATTTCTCAATTCTTTACCCCTTTGGATTCTGTTTCAGTTCTGTTTGTGTTCTGTTGCCTTGATTTCCCACTTGGTTGCCTCCTGGTTCTCTGTGTCGATAGCTCCCTACATTTCTGCTTTTGTGCTTTTTAAGATGATAAACCTTTTTGCGCAGAAAGATATATAGCGAGTTTACTACTAGTGCTAGCTAGTTATCAGCTTCTCCGCTTGAGCATTGCAGTTAGATCCAGAACTTGAGCTAAAATAAAATGGTTCTGTTTTCGTGTCAAATTTCTGGTAATTGTTGTGATTCTGATGTTAGCTTAACAGAATGCCCCATCTTGCTATCACGAGACGAATAAGCACTGAGCACGCAAGCAATTATACTTCTTTGTTTTTTTCTCTTCCATATTATCTATATACATATCAAGGGTTCTCCCCTACCTTAACTATGAAACGTGATTAATAGCTATGTAGGTATTTCTCAATGCAATACCCAGTCCTCTCTCCTAGCTACGAACCCGCTTTTTTATTATCACTTCACATTCCGTAAACCAAAAATAATTTAGAAAAAATATATATTCAGAGAACATAAAAGAAGGGGAGAAAGGGAAATGTGGAAGAAAGAACCTATTTTACTTCCTCACCTCCGCAAAAGCCTCCTTCATCGCCACGATGGCCTTGTCAACATCATCCCGTCCAGGCCCCGTTACGCTAACCCCCATATGCCCGAACCGGATATACTTGGACGCAATCTCCTTATGCAAACCCCCGGCAAACACAACACCCTTCTTCGCGAGCACCGGCAGGATATCAGGCGGGGTCATGCCCTCAGGCAACCGGATGGCCGTCATGGCATTAGCCTGGTCCTCCGGCTTAGTCGCCAGCTGTTGCAATCCCAGCTCAGCAACGGCCTTCTTAACACGCTGCGAAGCAGCCTTGTGTGCCTCAAAGCGCTCCGCCAGTGGCTTGCTGGTCACTTGCGTCAGGGTGGTGTGCAAGGCATGCACGAGCTGAGTGGCCGGTGTGGCGAAGTAAGAAGGTTTGCCAGCTTCATAGTTCCGCATGATGGGCAGCCAGTTTGCCATGGAGGCATAGTAGCTGGCGGGCGGGGACTGGCGGTTCTGGAAGCGCTGAATGGCGCGGCCGGAGACCATGACCACGCTG >UAMH03008_LCZI01001460 ATACATGAATATCAGTAATAAAAAAACTTGACTATAATCTAGTTATATCTTTCAAAACTTCATCTCTAACTTCATATATCACTTTTTTTATATCAATATCATCTACTCTTCAATGCTGTCTTTTCTATAATTTTTAATCTCACTCTAGCTCTGCATTCTTCAACTTTAATAAACTCATCATTTTTCTTTCTTATCTTCTGACAGAGCTCTACAATGCACACAGTAACTTTAAAATAGAAATTATTCATATGTTCATTTAATATTCAAGTTTAAAAGCTGACTCTCTCATTTAAACTAGACTGACTAAGATCTTTCTTCTCTTTACTCTTTACATTACTAGCTATTAATGAATTAACTTTGATGACATGACAGATGCATGCAAACTCAGTGTGAAATATTGAATTCAATTTAATTATTGAAATATACTCAAAAACAAAGAAATACAGAAGAGATTAAAAGATGAAGAGCTGAGTTTATAGAGAGATAAAATAAGTGATGTGAAGATTCATGCTGTGAGTGATATATAATTGTGCTGTCTGATTATAATTTATAAAAGCTTTCAGACTAATACTGTAGTGAAATACAGAAGCTGATAAATAATAAGACTGAAGCTGTCTTCAATTATCAATGCTTGTTTAAATTATAAATTTAAATTTCTTATGCTAACTCTTGATTTCTATAATAGATTAATAAGAAGAAGTGTGCTGTTCATCTTCAAGTATACTGAGTTATATATCAAGAAGTACTGTGATGTGAAAGATAAGAAAATTTATCTGACTCATTTAATTAAATAGCAGAGTAACTTTGAAGTTCTCATTTATCTATATTAAGAAGTAAGTCTCACTCTCTCAATGACTCTTTACTATTTAATTAATAGTTAAATCTTTTCATCACAGTATTAATAAGATTGCTTTCAAGCTCTGTATAATCTTGCAGCTTCTTCATCTTTAGATTAATAACAGTGTCTTCATTCATCTCACTAAAATTATTCAGAAAATGTTTATCATTGTTAATTTCTATATTATCTACACTTATTCTAATCTGAAGTCTGTTCACAAACTTATCTACAAGCACAGTTATAAAAAGATTAATATTGCTCTCAGCAATAATCAGATCATTGAAAAGAATCTAAATAATAAAAAAATATATAATAATCTTGAAATTTAAATCTGAAGCTCTTTTTCAGTCAGAATA >UAMH03008_NR_132795 AAGGATCATTAACGCGCCGTGGGGGGTCGGCCCCTAACCGGGACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTCTACCTGTTGCTTCGGCGGGCCTGCAGCAATGCTGCCGGGGGAGTCTTCTCTCCCCGGGCCCGCGCCCGCCGAGGACACCCTAGAACCTCCGGTTAAAGATTGACGTCTGAGACATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTTGAGGCCCGGCCGACTCCGGCCCCCACTCAACACCCGGGGGGTCTTCGGACCCCCCGACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAA >UAMH03008_AF071864_LSU CTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGCTTCGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGTGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATCGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCGTGGGCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCACCTTCGGGGTGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTT >UAMH03008_AF038334_SSU-LSU AAGGATCATTAACGCGCCGTGGGGGGTCGGCCCCTAACCGGGACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTCTACCTGTTGCTTCGGCGGGCCTGCAGCAATGCTGCCGGGGGAGTCTTCTCTCCCCGGGCCCGCGCCCGCCGAGGACACCCTAGAACCTCCGGTTAAAGATTGACGTCTGAGACATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTTGAGGCCCGGCCGACTCCGGCCCCCACTCAACACCCGGGGGGTCTTCGGACCCCCCGACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGTGGCCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCACCCTTCGGGGTGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGACC

IMAGES: