<< back to search

Search Details

add to cart



UAMH Number:3398
Species Name: Blastomyces helicus
Type:
Synonyms: Emmonsia helica
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: Sekhon, A.S. (PM 428) -> UAMH
Substrate: spinal fluid male, post mortem; atypical
Location: CANADA Alberta, Edmonton, University of Alberta Hospitals (GEO: 53.52,-113.523)
Isolator:
Isolation Date: 1970-12-28
Date Received: 1971-01-18
Characters: CULTURE CONDITIONS poor converstion to yeast state // HUMAN/ ANIMAL PATHOGEN atypical isolate, meningitis - Sekhon et al. Mycopathologia 68:53-63, 1979 // HUMAN/ ANIMAL PATHOGEN atypical isolate, meningitis - Sekhon et al., Mycopathologia 79:65-69, 1982 // MOLECULAR SYSTEMATICS 5-gene tree placed this strain in the genus Blastomyces - Dukik et al., Mycoses 60(5): 296-309, 2017
Compounds:
Cross Reference: CBS 139874
Pathogenic Potential: Human: yes | Animal: yes | Plant: no
Biosafety Risk Group: RG3 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 821083
Sequences: >UAMH03398_EF592153_SSU-LSU GGATCATTAACGCGCCGTGGGGGGTCGGACCCCGAACCCGGGTAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTCTCGCTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACCTCTGGTGAACGAATGACGTCTGAGACCATAACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCCTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAACCCCTTCGCGGGAGGGCGGTCTTCGGACCGGTCTCCCCACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGCGGGCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGACC

IMAGES: