<< back to search
Search Details
add to cart
| UAMH Number: | 4482 |
|---|---|
| Species Name: | Cutaneotrichosporon cutaneum |
| Type: | |
| Synonyms: | Basidiotrichosporon cutaneum / Candida balzeri / Geotrichoides balzeri / Geotrichoides paludosus / Geotrichum cutaneum / Geotrichum hirtum / Monilia balzeri / Monilia cutanea / Mycoderma cutaneum / Mycotorula mucinosa / Neogeotrichum pulmoneum / Oidium cutaneum / Oidium pulmoneum / Oospora cutanea / Oospora granulosa / Parendomyces balzeri / Proteomyces balzeri / Proteomyces cutaneus / Saccharomyces balzeri / Trichosporon aneurinolyticum / Trichosporon balzeri / Trichosporon cutaneum / Trichosporon cutaneum var. cutaneum / Trichosporon equinum / Trichosporon granulosum / Trichosporon minus / Trichosporon pardi / Trichosporum balzeri / Trichosporum cutaneumshow more |
| Taxonomy: | FUNGI Basidiomycota, Tremellomycetes, Trichosporonales, Trichosporonaceae |
| Strain History: | J. Buck (WR 112) -> Kaneda -> UAMH |
| Substrate: | sewage effluent water | Location: | USA Connecticut, Willimantic River (GEO: 41.745,-72.238) |
| Isolator: | J. Buck (WR 112) |
| Isolation Date: | |
| Date Received: | 1981-11-23 |
| Characters: | CULTURE CONDITIONS colony moist, white powdery - fide UAMH // MOLECULAR SYSTEMATICS Closest match (9 bp difference) to T. shinodae AB180201 - fide UAMH (Click for publications citing UAMH 4482) |
| Compounds: | |
| Cross Reference: | ATCC 32967 // WR 112 |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: yes | Animal: yes | Plant: no |
| Biosafety Risk Group: | RG2 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 813398 |
| Sequences: | >UAMH04482_UAMH_ITS CATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACACCTGTGAACTGTTGATCAACTTCGGTTGATTGCTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGCGTTGCCAGTAGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTTAACTTGTCGTATCTGGCGTAATAAGTTTCGCTGGAGTAGACTTGAGAAGTGCGCTTCTAATCGTCTTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT |
Images
There are no images in this gallery.