<< back to search

Search Details

add to cart



UAMH Number:4521
Species Name: Phanerochaete chrysosporium
Type: Sporotrichum pulverulentum
Synonyms: Grandiniella chrysosporium / Phanerochaete macrocystidiata / Phanerodontia chrysosporium
Taxonomy: FUNGI Basidiomycota, Agaricomycetes, Polyporales, Phanerochaetaceae
Strain History: T.I. Novobranova -> Burdsall, H. (VKM-F-1767) -> UAMH
Substrate: grape fruit and petiole (Vitis vinifera)
Location: KAZAKHSTAN Almaty, A.U.C of Micro-Org. (GEO: 43.251,76.928)
Isolator: T.I. Novobranova
Isolation Date: 1968
Date Received: 1982-03-01
Characters: APPLICATION Decolorization of textile-industry wastewater - Biotechnol. Lett. 17: 761-764, 1995 // APPLICATION ligninolytic enzymes - Pickard et al., Can. J. Microbiol. 45:627-631, 1999 // APPLICATION metabolism of polycyclic aromatic hydrocarbons - Pickard et al., Applied Env. Microbiol. 65:3805-3809, 1999 // APPLICATION oxidation of dibenzyl sulfide to dibenzyl sulfoxide - van Hamme JD, Wong ET, Dettman H, Gray MR, Pickard MA, Appl. Env. Microbiol. 69:1320-1324, 2003 // BENOMYL resistant - Environ. Sci. Technol. 25: 1329-1333, 1991 // BIODETERIOGEN/ BIODEGRADATION 2,4,5-trichlorophenol - Biotechnol. Bioeng. 46: 599-609, 1995 // BIODETERIOGEN/ BIODEGRADATION 2,4,5-trichlorophenoxyacetic acid - Appl. Microbiol. Biotechnol. 31: 302-307, 1989 // BIODETERIOGEN/ BIODEGRADATION 2,4,6-trichlorophenol - Appl. Environ. Microbiol. 60: 1711-1718, 1994 // BIODETERIOGEN/ BIODEGRADATION 2,4,6-trichlorophenol - Biotechnol. Bioeng. 46: 599-609, 1995 // BIODETERIOGEN/ BIODEGRADATION 3,4-dichloroaniline and benzo(a)pyrene - Soil Biol. Biochem. 25:279-287, 1993 // BIODETERIOGEN/ BIODEGRADATION Acid Yellow 9 and other azo dyes - Appl. Environ. Microbiol. 58:3605-3613, 1992 // BIODETERIOGEN/ BIODEGRADATION aldrin, chlordane, dieldrin, heptachlor, lindane, and mirex - Appl. Environ. Microbiol. 56:2347-2353, 1990 // BIODETERIOGEN/ BIODEGRADATION Amaranth, Azure B, and Orange G - World J. Microbiol. Biotechnol. 10: 556-559, 1994 // BIODETERIOGEN/ BIODEGRADATION atrazine - Appl. Environ. Microbiol. 60: 705-708, 1994 // BIODETERIOGEN/ BIODEGRADATION atrazine - Soil Biol. Biochem. 26: 1665-1671, 1994 // BIODETERIOGEN/ BIODEGRADATION azo dyes - Appl. Environ. Microbiol. 58: 3598-3604, 1992 // BIODETERIOGEN/ BIODEGRADATION azo dyes - World J. Microbiol. Biotechnol. 8: 309-312, 1992 // BIODETERIOGEN/ BIODEGRADATION Azure B, Congo Red, Tropaeolin O, and Orange II - Appl. Environ. Microbiol. 56: 1114-1118, 1990 // BIODETERIOGEN/ BIODEGRADATION benzene, ethylbenzene, toluene and xylene - Appl. Environ. Microbiol. 59: 756-762, 1993 // BIODETERIOGEN/ BIODEGRADATION biphenyl and polychlorinated biphenyls - Biotechnol. Bioeng. 40: 1395-1402, 1992 // BIODETERIOGEN/ BIODEGRADATION cellobiohydrolase genes - Curr. Genet. 22: 407-413, 1992 // BIODETERIOGEN/ BIODEGRADATION creosote - Appl. Environ. Microbiol. 61: 2631-2635, 1995 // BIODETERIOGEN/ BIODEGRADATION cyclotrimethylene trinitramine (=RDX) - Appl. Biochem. Biotechnol. 34/35: 709-723, 1992 // BIODETERIOGEN/ BIODEGRADATION DDE (=1,1-dichloro-2,2-bis(4-chlorophenyl)ethene) - FEMS Microbiol. Lett. 94: 209-216, 1992 // BIODETERIOGEN/ BIODEGRADATION DDE (=1,1-dichloro-2,2-bis(4-chlorophenyl)ethene) - Mycol. Res. 97:95-98, 1993 // BIODETERIOGEN/ BIODEGRADATION DDT - Appl. Environ. Microbiol. 53: 2001-2008, 1987 // BIODETERIOGEN/ BIODEGRADATION evaluation of surfactants in stimulating degradation of polycholorinated biphenyl congeners - Beaudette et al., Letters in Appl. Microbiol. 30:155-160, 2000 // BIODETERIOGEN/ BIODEGRADATION fluorene in soil - Biotechnol. Bioeng. 33: 1306-1310, 1989 // BIODETERIOGEN/ BIODEGRADATION lignin - Appl. Environ. Microbiol. 60: 4509-4516, 1994 // BIODETERIOGEN/ BIODEGRADATION lignin - FEMS Microbiol.Lett. 29: 37-41, 1985 // BIODETERIOGEN/ BIODEGRADATION lindane - Pestic. Sci. 47: 51-59, 1996 // BIODETERIOGEN/ BIODEGRADATION low biodegradation and mineralization of polycholorinated biphenyl congeners - Beaudette et al., Appl. Env. Microbiol. 64:2020-2025, 1998 // BIODETERIOGEN/ BIODEGRADATION o-chlorophenol - Hazard., Waste & Hazard. Mater. 9: 213-229, 1992 // BIODETERIOGEN/ BIODEGRADATION o-chlorophenol - Water Res. 24: 75-82, 1990 // BIODETERIOGEN/ BIODEGRADATION olive-mill wastewater - Appl. Microbiol. Biotechnol. 37: 813-817, 1992 // BIODETERIOGEN/ BIODEGRADATION pentachlorophenol - Appl. Environ. Microbiol. 54: 2885-2889, 1988 // BIODETERIOGEN/ BIODEGRADATION pentachlorophenol - Biotechnol. Bioeng. 35:1125-1134, 1990 // BIODETERIOGEN/ BIODEGRADATION phenanthrene and other polycyclic aromatic hydrocarbons - Appl. Environ. Microbiol. 55: 154-158, 1989 // BIODETERIOGEN/ BIODEGRADATION phenanthrene and other polycyclic aromatic hydrocarbons - Appl. Environ. Microbiol. 58:3000-3006, 1992 // BIODETERIOGEN/ BIODEGRADATION pine and straw alkali lignins - Eur. J. Appl. Microbiol. Biotechnol. 14: 174-181, 1982 // BIODETERIOGEN/ BIODEGRADATION pulp and paper-mill wastewater - Biotechnol. Lett. 12: 869-872, 1990 // BIODETERIOGEN/ BIODEGRADATION pulp and paper-mill wastewater - J. Biotechnol. 24: 267-275, 1992 // BIODETERIOGEN/ BIODEGRADATION Rose Bengal - Lett. Appl. Microbiol. 14: 58-60, 1992 // BIODETERIOGEN/ BIODEGRADATION sulfanilic acid - Appl. Environ. Microbiol. 58: 3598-3604, 1992 // BIODETERIOGEN/ BIODEGRADATION treatment of methane and swine slurry by biofiltration - Girard M, Viens P, Ramirez AA, Brzezinski R, Buelna G, Heitz M, J Chem Technol Biotechnol 87:697-704, 2012 // BIODETERIOGEN/ BIODEGRADATION trinitrotoluene. TNT - Appl. Biochem. Biotechnol. 34/35: 709-723, 1992 // BIODETERIOGEN/ BIODEGRADATION trinitrotoluene. TNT - Appl. Environ. Microbiol. 56: 1666-1671,1990 // BIODETERIOGEN/ BIODEGRADATION trinitrotoluene. TNT - Curr. Microbiol. 28: 185-190, 1994 // BIODETERIOGEN/ BIODEGRADATION veratryl alcohol and its methyl ether by lignin peroxidase - Biochemistry 28: 1776-1783, 1989 // BIODETERIOGEN/ BIODEGRADATION white rot // CULTURE CONDITIONS UV - Environ. Sci. Technol. 25: 1329-1333, 1991 // MOLECULAR SYSTEMATICS Concordia Univ Fungal Genomics Project - https://fungalgenomics.concordia.ca/fungi/Pchr.php // MOLECULAR SYSTEMATICS glyoxal oxidase cDNA - Proc. Natl. Acad. Sci. USA 90: 7411-7413, 1993 // MOLECULAR SYSTEMATICS identification of fungal enzymes for industrial and environmental applications - https://fungalgenomics.concordia.ca/home/index.php // THERMOTOLERANT
Compounds: ARYL-ALCOHOL DEHYDROGENASE Eur. J. Biochem. 195: 369-375, 1991 // CELLOBIOSE:QUINONE OXIDOREDUCTASE Biochim. Biophys. Acta 1119: 90-96, 1992 // COAL-SOLUBILIZING AGENTS Biodegradation 5: 55-62, 1994 // EXTRACELLULAR PEROXIDASE FEMS Microbiol. Lett. 29: 37-41,1985 // EXTRACELLULAR PEROXIDASE J. Biol. Chem. 262: 419-424, 1987 // GLYOXAL OXIDASE J. Bacteriol. 169: 2195-2201, 1987 // GLYOXAL OXIDASE Proc. Natl. Acad. Sci. USA 87: 2936-2940, 1990 // LIGNIN PEROXIDASE Acta Biotechnol. 12: 191-201, 1992 // LIGNIN PEROXIDASE AND MANGANESE PEROXIDASE FEMS Microbiol. Rev. 13: 125-135, 1994 // LIGNIN PEROXIDASE Appl Environ Microbiol 59:1919-1926, 1993 // LIGNIN PEROXIDASE Arch. Biochem. Biophys. 279: 158-166, 1990 // LIGNIN PEROXIDASE Bio-Technology 6:571-573, 1988 // LIGNIN PEROXIDASE Enzyme Microb. Technol. 11: 322-328, 1989 // LIGNINASE AND PEROXIDASE J. Biotechnol. 2: 379-382, 1985 // N-(CHLOROPHENYL)-SUCCINIMIDES Pestic. Biochem. Physiol. 27: 173-181, 1987 // NADH:QUINONE OXIDOREDUCTASE J. Gen. Microbiol. 137: 2209-2214, 1991 // XYLANASE Appl. Environ. Microbiol. 58: 3466-3471, 1992
Cross Reference: ATCC 24725 // BKM-F-1767 (in literature // CBS 481.73 // CCRC 36200 // CECT 2798 // IMI 174727 // LCP 87.3505 // MUCL 19343 // NRRL 6361 // QM 9998 // VKM-F-1767 // VTT D-85242 // VTT D-86270
Pathogenic Potential: Human: yes | Animal: no | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 319705
Sequences: >UAMH04521_L18991 AGACTTACGATGTTGTCGCTGCTAGCCGTAGTCTCACTCGCCGCCGCCACACTCGCTGCTCCAGCTGCCAGCGATGCACCAGGCTGGCGGTTCGACCTGAAGCCCAACCTTTCCGGGATCGTGGCTCTCGAGGCGATCGTCGTGAACAGCTCACTGGTGGTCATATTCGACCGCGCCACCGGCGATCAGCCTCTCAAGATCAACGGCGAATCGACCTGGGGTGCGCTCTGGGATCTCGATACGAGCACTGTCCGCCCGCTTTCGGTCCTGACGGACTCCTTCTGCGCCAGCGGTGCGCTGCTCAGCAATGGCACTATGGTCAGCATGGGAGGAACCCCTGGCGGTACTGGAGGGGATGTTGCTGCTCCTCCTGGCAACCAGGCGATCCGGATCTTCGAGCCCTGCGCCTCGCCTTCGGGAGATGGCTGCACGCTCTTCGAAGACCCTGCGACTGTTCATCTCCTTGAGGAGCGGTGGTACCCATCGTCCGTGCGCATTTTCGATGGCAGTCTCATGATCATTGGTGGTTCGCATGTCCTCACACCGTTCTACAACGTCGATCCAGCCAACTCCTTCGAGTTCTTCCCAAGCAAGGAGCAGACGCCCAGGCCTTCAGCCTTCTTGGAACGCTCGCTGCCAGCGAATCTTTTCCCACGGGCTTTCGCCTTGCCAGACGGAACCGTCTTTATCGTCGCTAATAACCAGTCTATCATCTACGATATCGAGAAGAATACTGAGACCATCCTCCCGGATATCCCCAACGGTGTTCGTGTCACGAACCCCATCGATGGAAGCGCCATCCTTCTCCCGTTGTCGCCCCCTGACTTCATTCCCGAGGTTCTCGTCTGTGGAGGCTCGACTGCGGACACCTCGCTCCCGTCCACCAGCTTGTCCTCCCAACATCCCGCTACCAGCCAATGCAGCCGGATCAAGCTCACCCCCGAAGGTATCAAGGCCGGCTGGCAGGTCGAACATATGCTTGAGGCGCGCATGATGCCTGAGCTCGTGCACGTCCCGAACGGCCAGATCCTCATCACCAACGGCGCTGGTACAGGCTTTGCCGCACTGTCTGCCGTCGCGGACCCCGTCGGCAACTCGAACGCGGACCACCCCGTGCTCACACCTTCGCTCTACACGCCCGACGCACCTCTTGGAAAGCGCATCAGCAACGCGGGCATGCCGACGACGACGATTCCGCGCATGTACCACTCGACCGTGACGCTCACGCAGCAGGGCAACTTCTTCATCGGGGGCAACAACCCGAACATGAACTTCACGCCGCCTGGCACACCCGGGATCAAGTTCCCCAGCGAGCTGCGCATCGAGACCCTCGACCCGCCGTTCATGTTCAGGAGCCGCCCCGCGCTTCTCACGATGCCTGAGAAGCTCAAGTTCGGCCAGAAGGTGACCGTGCCTATCACGATCCCGAGCGACCTGAAGGCGAGCAAGGTCCAAGTCGCCCTGATGGACCTCGGCTTTTCGAGCCACGCCTTCCACTCCAGTGCGCGCCTCGTCTTCATGGAGTCGTCCATCTCGGCGGACCGCAAGTCGCTCACCTTCACGGCTCCGCCCAACGGACGCGTCTTCCCACCGGGCCCGGCTGTCGTTTTCCTCACGATTGACGACGTGACAAGTCCGGGAGAGAGAGTCATGATGGGCAGTGGCAACCCTCCGCCGACCCTGGAGTAAATATGGAGTGTTCGCGGGTACCTCGGCGCAGACCTTGTCTTGACTGTTGTGGTGCGGTATGTACGTTGTTTTTTGTTGTGAGCTCGAAAGTTGCATATGAAATATCTGTTTGGGCG

IMAGES: