<< back to search
UAMH 5628 — Leptodophora orchidicola
add to cart
| UAMH Number: | 5628 |
|---|---|
| Species Name: | Leptodophora orchidicola |
| Type: | |
| Synonyms: | Cadophora orchidicola / Leptodontidium orchidicolashow more |
| Taxonomy: | FUNGI Ascomycota, Leotiomycetes, Helotiales, Leptodontidiaceae |
| Strain History: | Currah, R.S. (RC 55a) -> UAMH |
| Substrate: | endophyte of white bog orchid Platanthera dilalata |
| Location: | CANADA Alberta, Castle River (GEO: 49.5,-114.222) |
| Isolator: | R. Currah (RC 55a) |
| Isolation Date: | 1985-06-20 |
| Date Received: | 1987-01-26 |
| Characters: | MOLECULAR SYSTEMATICS molecular characterization reidentified as L. orchidicola - Addy et al., Mycol. Res. 104:1213-1221, 2000 // MOLECULAR SYSTEMATICS RFLP & ITS sequence comparison of Phialocephala fortinii & L. orchidicola - Addy et al., Mycol. Res. 104:1213-1221, 2000 // MOLECULAR SYSTEMATICS UAMH 5628 excluded from other P. fortinii isolates - Harney et al., Mycol. Res. 101:1397-1404, 1997 // MYCORRHIZAE endophyte orchid Platanthera dilalata (Click for publications citing UAMH 5628) |
| Compounds: | |
| Cross Reference: | |
| Collections: | Living Strains; Dried Herbarium Material |
| Pathogenic Potential: | Human: no | Animal: no | Plant: yes |
| Biosafety Risk Group: | RG1 (check the PHAC ePATHogen Risk Group Database for updates) |
| Regulatory Requirements: | No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database |
| MycoBank ID: | 133341 |
| NCBI Taxonomy ID: | 1732013 |
| GBIF Taxon Key: | 2584843 |
| Sequences: | >UAMH05628_AF214578_SSU-LSU CATTACTAGAGCAAAGGATAGACAGCGCCCGCGGAGCTCGCTCCCGGGGCTACCCTACTTCGGTAGGGTTTAGAGTCGTCGGGCCTCTCAGAGAAGCTCGGTCCTGAACTCCACCCTTGAATAAACTACCTTTGTTGCTTTGGCGGGCCGCCTCGTGCCAGCGGCTTCGGCTGTTGAGTGCCCGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCTCTCGCTTGGTATTGGGGTTCGCGGTTTCGCGGCCCCTAAAATCAGTGGCGGTGCCTATCGGCTCTACGCGTAGTAATACTCCTCGCGATTGAGTCCGGTAGGTCTACTTGCCAGCAACCCCTAATTTTTTTAAGGTTGACCTC |
Images
There are no images in this gallery.