<< back to search

Search Details

add to cart



UAMH Number:7299
Species Name: Polytolypa hystricis
Type: Polytolypa hystricis
Synonyms:
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: J. Scott (JS 189) -> UAMH
Substrate: porcupine dung (Erethizon dorsatum)
Location: CANADA Ontario, Muskoka District, Stoneleigh Township Road 16 (GEO: 45.1,-79.25)
Isolator: J. Scott
Isolation Date: 1990-09-16
Date Received: 1993-03-02
Characters: CULTURE CONDITIONS produced ascomata // MOLECULAR SYSTEMATICS Whole genome sequence PRJNA234736 // PIGMENT brown // PIGMENT yellow green on OAT - fide UAMH 2013
Compounds: POLYTOLYPIN, A PENTACYCLIC TRITERPENOID, ANTIFUNGAL AGAINST C. ALBICANS & SOME COPROPHILOUS FUNGI Gamble et al., J. Nat. Prod. 58:1984-1986, 1995
Cross Reference: TRTC 51349 (holotype)
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 360381
Sequences: >UAMH07299_NR_111161 GGATCATTACCGTGCCGTGGCCGCTCGCCCCTAAAAGGCGGGCGGCTCACCGTGCCACCCGTGTCTACTTTACCTGTTGCTTCGGCGGGCCTGCGGGCCTCGCTCGCTGCCGGGGGATTCGTCCCCGGGCTCGTGCCCGCCGGAGACACACTAAACCTCCAGTTAAGAATACAGTCTGAGTGATTAAGAAATTAATTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGATGGGCCTCGTCCCCCGTGGACGGGCCCGAAATGCAGTGGCGGTACCGTGCTCCGGTGCCCGAGCGTATGGGCTTTATCACCCGCTCTAGTGGCCCGGCCGGTGCTGGCCGAACCCCAACTACTTCTATGGTTGACCTCGGATCAGGTAAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGG >UAMH07299_ITS GACATTACGTGCCGTGGCCGCTCGCCCCTAAAAGGCGGGCGGCTCACCGTGCCACCCGTGTCTACTTTACCTGTTGCTTCGGCGGGCCTGCGGGCCTCGCTCGCTGCCGGGGGATTCGTCCCCGGGCTCGTGCCCGCCGGAGACACACTAAACCTCCAGTTAAGAATACAGTCTGAGTGATTAAGAAATTAATTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGATGGGCCTCGTCCCCCGTGGACGGGCCCGAAATGCAGTGGCGGTACCGTGCTCCGGTGCCCGAGCGTATGGGCTTTATCACCCGCTCTAGTGGCCCGGCCGGTGCTGGCCGAACCCCAACTACTTCTATGGTTGACCTCGGATCAGGTAA >UAMH07299_AY176718_LSU GAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGGGCGGTTGCGGTCTAAGTTCCCTGGAAAGGGGCATCGTAGAGGGTGAGAATCCCGTCTTCGGCCGGCTAACCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGATTCGGCCGCGGAGGCTCAGCGGGCATTCTTGCCTGTGCACTCCCCCGCGGTCCGGGCCAGCATCAGTTTAGGCGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCCTTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGTCAGCCCGGACTGAGGAACGCGCTTCGGCACGGATGCTGGCATAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCACGCGAGTGTTCGGGTGTCAAACCCGTCCGCGCAGTGAAAGCGAACGGAGGTGGGAGCCCTTAAGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCGTGACTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTGGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAGCGTTTTCAGTTTTATGAGGTAAAGCGAATGATTA >UAMH07299_KP119650_SSU CTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATCTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCAATTCGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTCGGGTCTCGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCCGGTCCGCCTCACCGCGTGCACTGGTCCGGCCGGACCTTTCCTTCTGGGGAACCCTATGGCCTTCACTGGCTGTAGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGGATACATTAGCATGGAATAATAGAATAGGACGTGTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATGGTCGGGGGCGTCAGTATTCAGCTGTCAGAGGTGAAATTCTTGGATTTGCTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGGTGTTTTTTTGATAACCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGT >UAMH07299_AY176700_SSU TAAGGGCTGAACCAGCAACTTGGAAGAATAGGAATTAGTAAGATCCGTGTAATTCTAAATAGAATAAAGATAATGACAATTTTCTATTTATAAGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATTAAACCTGTTAAGGGAATTTTTTTACTAGAGTTTTATAGGAGAAGGTAGAATTCTTGGAGTAGGGATAAAATATTTTAATACCAAGGAGACAGGTAACGGCGAAGGCGGCCTTCTATGTAAAAACTGACGTTGAGGGACGAAGGCTTGGGTATCGAGAAGGATTAGATACCCTAGTAGTCCAAGCAGAAAATTATGAATGCCATAAGCTAGATATTATTTAGCATATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAAGATGGCAACATTGAAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGT >UAMH07299_AY527405_SSU-LSU GGATCATTACCGTGCCGTGGCCGCTCGCCCCTAAAAGGCGGGCGGCTCACCGTGCCACCCGTGTCTACTTTACCTGTTGCTTCGGCGGGCCTGCGGGCCTCGCTCGCTGCCGGGGGATTCGTCCCCGGGCTCGTGCCCGCCGGAGACACACTAAACCTCCAGTTAAGAATACAGTCTGAGTGATTAAGAAATTAATTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGATGGGCCTCGTCCCCCGTGGACGGGCCCGAAATGCAGTGGCGGTACCGTGCTCCGGTGCCCGAGCGTATGGGCTTTATCACCCGCTCTAGTGGCCCGGCCGGTGCTGGCCGAACCCCAACTACTTCTATGGTTGACCTCGGATCAGGTAAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGG

IMAGES: