<< back to search

Search Details

add to cart



UAMH Number:7956
Species Name: Trichoderma longibrachiatum
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Sordariomycetes, Hypocreales, Hypocreaceae
Strain History: Rinaldi, M.G. (UTHSC 94-1620) -> UAMH
Substrate: multiple isolations from stool, ulcer biopsy, liver and heart, DE+
Location: UNKNOWN (GEO: ?,?)
Isolator:
Isolation Date:
Date Received: 1995-06-06
Characters: APPLICATION rapid identification by isoenzyme analysis - Szekeres A, Laday M, Kredics L, Varga J, Antal Z, Hatvani L, Manczinger L, Vágvölgyi C, Nagy E, Clinical Microbiology and Infection 12:369-375, 2006 // BIODETERIOGEN/ BIODEGRADATION extracellular proteolytic enzymes - Kredics L, Antal Z, Szekeres A, Manczinger L, Doczi I, Kevei F, Nagi E, Acta Microbiologica et Immunologica Hungarica 51:283-295, 2004 // MOLECULAR SYSTEMATICS genetic diversity based on mitochondrial DNA profiles - Antal Z, Varga J, Kredics L, Szekeres A, Hatvani L, Manczinger L, Vágvölgyi C, Nagy E, Medical Microbiology 55:31-35, 2006 // PIGMENT yellow // SYSTEMATICS/ TAXONOMY Trichoderma sect. longibrachiatum - Samuels et al., Stud. Mycol. 41:1-53, 1998
Compounds:
Cross Reference: UTHSC 94-1620 // UTMB 3577
Pathogenic Potential: Human: yes | Animal: no | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 340300
Sequences: >UAMH07956_EU401465 TGCAACTCTGCTGCGGCAAACCTGGTAGGGAAGGCGTTTTCAGGGTGCTAACCGAGCTGCTACAGGACAAGGACGGTGATGGTACGTGACGGCGAGTGACGCGACAACACACCTATTTCTCTCTCTACGAGCCCGCACCGAAGCATTCATTGCCGATCGATAGCCCTCTCGCACGCTCGAATGATTGATAAATGGACACGATAAACTGACAGGCTTGACCCCGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGTTCCATCGACTTCCCTGGTACGTGACTTGTCGCAAGATTTGGTGGCCAAGGTATATGGGCTAACATGGAGCGGTGAAGAATTTCTCACCATGATGGCCAGAAAGATGA >UAMH07956_EU401517 AGCAACGCCTCCGGCCACGACGCCAACTTGTATGCCAACCCGCAGAACCCCAACGCAACGCCCTTCAACACCGATGATGCTGTCAAGGCCTACATCAAGGGCGGTGTTCCTGCAAACAAGATTGTCCTCGGCATGCCCATCTATGGCCGATCCTTTGAGTCCACCTCTGGCATTGGCCAGCCCTTTAACGGAATCGGGTCTGGTAGCTGGGAGAACGGTGTCTGGGATTACAAGGCCCTGCCCAAGGCCGGCGCTACCGTCCAGTATGATGACGTCGCCAAGGCTTCCTACAGCTATGACCCCAGCACGAAGGAGCTCATCTCTTTCGATACCCCTGATGTGATCAACACCAAGGTGGCTTACCTCAAGTCTCTTGGCCTGGGCGGCAGCATGTTCTGGGAAGCCTCGGCCGACAAGAAGGGAGCTGACTCGCTGATTGGGACAAGCCACAAGGCTCTTGGGGCCCTTGAC >UAMH07956_EU401597 ATCTTTTTTTTCACACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATCCTCTGCCGCCCTCTGCTCTCGTCTCCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAATGCTAATCATTTTCCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCAAGCGTCCCACGGACAGCCCCTGCGTCTGCCCCTGCAGGACGTCTACAAGATCGGTGGTATC >UAMH07956_AY328041_SSU-LSU AGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAG

IMAGES:

There are no images in this gallery.