<< back to search

Search Details

add to cart



UAMH Number:9184
Species Name: Penicillium rubens
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Eurotiales, Aspergillaceae
Strain History: K.B. Raper -> ATCC 9480 -> UAMH
Substrate: cantaloupe fruit (Citrullus lenotus)
Location: USA Illinois, Peoria (GEO: 40.694,-89.589)
Isolator: K.B. Raper
Isolation Date: 1943
Date Received: 1998-02-18
Characters: APPLICATION production of disulfide reductase - J. Bacteriol. 176: 973-984, 1994 // APPLICATION production of ferrichrome - Mol. Cell. Biol. 1: 94-100, 1981 // APPLICATION production of penicillin - J. Gen. Microbiol. 136:1713-1716, 1990 // APPLICATION production of: antiviral agent consisting of double-stranded RNA - U.S. Pat. 3,597,318 // APPLICATION Prototype of high-yielding penicillin strains in submerged culture. Infected with mycoviruses - J. Virol. 6: 813-819, 1970 // APPLICATION transformation of sesquiterpene lactone costunolide - J. Chem. Soc. Perkin Trans. 1979:3022-3028, 1979 // APPLICATION Wisconsin strain, parent of most high yielding penicillin producing strains - Houbraken J, Frisvad JC, Samson RA, IMA Fungus 2:87-95, 2011 // MOLECULAR SYSTEMATICS sequences of 3-phosphoglycerate kinase gene pgKA - Mol. Gen. Genet. 243: 270-276, 1994 // MOLECULAR SYSTEMATICS sequences of large mitochondrial rRNA gene (GeneBank D13859) - Biochim. Biophys. Acta 1172: 353-356, 1993 // MOLECULAR SYSTEMATICS sequences of thioredoxin reductase genes trxA and trxB, EMBL X76120 and X76119 - J. Bacteriol. 176: 973-984, 1994 // MOLECULAR SYSTEMATICS “Wisconsin strain” parent of penicillin producing strain is reidentified as Penicillium rubens - Houbraken J, Frisvad JC, Samson RA, IMA Fungus 2:87-95, 2011
Compounds:
Cross Reference: ATCC 9480 // CBS 307.48 // EMBL X76119 // EMBL X76120 // IMI 040233 // NRRL 1951 // QM 941
Pathogenic Potential: Human: no | Animal: no | Plant: no
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: No restrictions for Canadian requesters. International requesters must provide all legally required importation documentation prior to shipment. This strain is not available for shipment to Cuba, the Democratic People's Republic of Korea, Iran or Syria. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 276884
Sequences: >UAMH09184_D13859 CAAATTAAATTAATGTAAATACATTATAGGTTTTACAGGTTAGTGTCCGGTGGTTGGTCGCTTCATTTGGGTTGGAGATTGTTTATGTTCGAATCATAATAACCTGATAATTAATATAGGTATAATTATATATACCAATATAGATGATATGTATCATATACATCTTGAGAAATCAAGACAAGTATATAAAGAAACTATTATGGATGGTTAGCTATATATTTCAAGATATTGATCTAGAAAAATATAAACTAGAAATCATAGAGAAATCTAATTATAAGACAAAGTGAATTGAAATATCTTAGTAACTTTAGTAAAAGAAATCAAACGAGATTGTTATTTGGTGTCTTCTGAATAGCAAAAGCCTTAATAAATAATTACTAAAATTAATGATAGTAATTATTTATAGTAAATATATTAAATGATATATTTAAGTATAACGGAAAAAAATCTGTTGAAAAATAGGGGAACCTTCCTCTAAGGCTAAAAAAAATATATAAGCGATAGAGTAACAGTACCGAGAGGGAAATACCCTGAAATAGTAGTTTTATAAGCAGCTCAAGTTAAAATTTAAATAAATAATAAGAGCGTACCTTTTGCATAATGGGTCAGCAAGTTAATTTTAGATGCAAGTAACATCTCTTTTATAAGCATTTACACATTTAGAATATTATCATTTACAATAGATGATAACAATATAGATATGTAAATTTATTAATAAAATTAGGAGATAGATACGTAGATAAACCAATTATGAAAAAATGAATTAGTATCTAGAATTAGACCCGAAGGCTAGTGATCTTACCATGGTCAGGGTTATAAAAGCCCGAACGGGTTATCGTTGTAAAGATATCCGATGAACTGTGGTAAGTTAGTGAAAGACAAAACTGACTAGTATAGCTGGTTTTCCGCGAAACCTATGTAAGTAGGTAATTTAATTAACATCTTAGCAGGTACAGAACTGTGATCTCGGACAATATTTAATATATTTGTCAACATCGGGGGGTTGTAGTGACTTTACCGGAGAGTATTTGCACTCGGAAGGGCAAAGATGAATGTTAAATAATCGGACATAGTGCGATAAGGTTGTATGTCTAAAGGGAAACAGCCCAGAACAAGAGTTAAGGTTCCAAAATTATTGTTAAGTGAAATTAAGGATGTTTTTTTTTAAAACAATCAGGAAATAGGCTTAGAAGCGGCCATTTTTTGAAGACCTCGTAACAGAGCACTGATTAATAAATTAGGAAAAAACGCCGAAAATTTAACGGATCTAAATAATATACCGAAACCTTGTACACAAATAAAAATTAAAGCGTTATAGCTTAATATTTTGTGGGGTAGCGGAACATTGGATTAAACAAAATATTAATATTTTTCTTAAAATATTAAAGATCTAGCATCTGTTAAATCCAAGAGAGAATGCTGACATGAGTAACGAAAAAGGCTTTTAGCCTCGCCTGAAGCTTATGGTTTCATCTAAAATCGGTGTCTAAAAAAATTAATCAAAAGATAATTTTGATGACGTTTTGTATAAGATAATACCAAAACCTTTAATAAGTAATAAAGGTTCTGGAAAAGTTTATTTTATTATTTGAAGTGAAAAATATTTAATACTCATACTTATTGGTATAAAATTGTAAATTATAATATATAATACATACTTATTATTATATTGTGATTTACAAATATAATAGAATGAGTAAAATAAATATATTTTAACCAAATAATAGTCTTTATCTATAATTATAATAATATAATATAATAATTATTAATAATTAATTACCATTAGATTATTAATATGTATTTATAGGCTATATTTGAATTGTATATCAAGATTCTTATATAGATATATCTATATCTATTAAACGTTATTAGAAATAATATTATAATATATAGAAAAGATAACATTATACTGGAAAATAATAAATAACCGTACCTAGAAACTAACTCAAGTAAGCAAGTAGAGAATACAAAGGCGTTTGAGAGAACAATCATTAAGGAACTCGGCAAATTGACTCTGTACCTTTGGAATAAGGAGGACCATTATTATTAAATTTAACATATAATAAAGTATGTAATTAAATATGAAAAATTAAATTAATAATAAGAGGAATCATGAAATAATGTTGTACGACTGTTTAATAAAAACACAGCACTCTGCAAAGATAAAAAATCAAAGTATTGAGTGTGATGTCTGCCCAATGTCGGCTGGGTAACGGATCTACCTTGATTATTAACTGAGGTTTTGAAGGACACCCCGATTAATGGCGGCCTTACCTATGAGGGTCCTAAGGTAGCGAAATACCTTGGCCGTTAAATGCGGTCCTGCATGAATGATTTAACGATGCAACAGCTGTCTCGATGATTGTCTCAGTGAAATTGGAATAGCAGTGCAGATACTGTTTACCTCTAGATAGACGAGAAGACCCTATGCAGCTTTACTGTTACTAATTATAAGAGTGAAATTTTAGGATGATTTATAGTGTATAAGGTAGTTGTTGAGATAATAATGAAACACCTTTATTCGAATCCTTATATATACTCTTAATGATTAGAAGGCAGTTTATGCGGGGCACAGATCCCACAAAAAGTACCTGGGTATATCCAAAGTTCATATTGTAAACTTGTATATTTATATACAAATATTTTAATTTGTTCTAATTATTATTATAATTATACAGTTATTATTCGATTAAATTCCACAATTATTTTTTATTTTAAGTAAGATTTTAACTATGCGGTGAATAGATGTATTTTAAACTTTACTGGACTTTTAGTTCAAAGATTTAAAAGTTTATTTGTTATATTAATAAAGTATTTATCTTTATTAATATAATATTTATTAATACTTTAAAAGTTTAATGGCTAAATCTTGCTTTACTGTTTGACCTACAAGTCTATCAGTCGCGTAAGCGGGGCATATGATCACAAGATGCATTAAGGAAAGGTCTTGGATTATAGAAAAAGTTACGCTAGGGATTTATAACTGTGAGTCCTCCAATATTATAAAATATTGGTAATATATTGGGTAAATTTCAAAGACAACTTATATTAATTAAGTGTATTTGAAGCGAAACTTATTTTAGCATGTGTTTATCTTTAAGATAAATTAAAATAAGGACGTTCAACGACTAAAAGGTGAGTATAGCTAACAATAATCCTTTTTTAACGCCCAACATCTTTATTAATTAATTAAAAACACTATTTGTATAATAATTATTATTTTTTAATAATGTATTAGACTTGGTTTACCAAGCTTTAATATTATATAATTAATTCTATTAATTATATTAATATATATATATATATATATAAATATGTTAAATATTATAAAATCAAAATTAAATACTACATATAAAAAAAAAGGATTAAATGATTCTAGTATAGCTATTTATAATAGAGATATAATACCTGCTGTAAGAAATTGAAAAAGTAGTATATATGCTTATAATAAAAATGCTATTAATTTAATTCCTATTAAAAGTAAATATGTAATGAAATTAATTAAAGCATACTTTAATTTATATAATTTACAACTAGAATCTTTATTAAGAAAAAATAGATTACGTCGTAGATTTAGAAAAATATCTACAAATAGAATATTTATTAGTGATGGTGAATTTAAACATACTAATGATAAAGTTAATATAACATTATATGTTTATAATAAACAAAAACTTAATTACTTATTAAAACTTAAAAAAAGATATTTAACATTATTTAAAAAAGCTAAATTTGCTAGAAAATTAAAATTAATAAAAAATATAGGATTAAATATTTTGTGTAAACATAAACAAAAAAGTATATTATTAAGTAATCTTTTACCTAAATACAATACTCAAGTAAATACAGCACAAAATATTTACTATTTAAGATTTATTAAAAAAAGTTTTAAAAGATTAAAATTCTATATGTATTATAAACAAATGCTTTATATAAATAAAGCTAAATTTGAAAATACTTATTTACAAGGTTTAATAAGTTTAGTAAAAAATATTTTTAATAAAAATGTTGAATTTAATATAATTAATTTAAAATATTTTTATTTTAATAGTAATATATTTACTCAACCTTTAGAATTAAAATTAAAAAAAAAAAGAAATGTTTTAAGATATCTTAAAGTTTTAATAAGAAAAGCAAAAATTAAAAATGTAAAATTAGCAGAAAAATCTAAAAAATTTTTTAATTTAAATATTTTTAATAGTGATAATTTTTTACAACAAGATAATACTAAATCTAAATACCTTAAAAAAATTATTTTAAGTGATTTAAAATATAAAAGAGTATCTGGTGTTAGATTAGAAGCTGCTGGTAGATTAACTAGACGTTTTTCAGCTTCTAGATCTCAACGTAGAACTAAATATAAAGGTAATTTAGAAAATGTTTATTCTTCATTTAAAGGTTATCCTACACCAATGTTAAGAGGAAATGATAAAGCTAATTTACAATATACTGTAATTAACTCAACTTCACGTGTTGGAGCTTTTGGTGTTAAAGGTTGAGTAAGTAGTACTTAATTTATCTTTTCTTTTTATTTACAATTTTCCCTCCCTTATATTAATTAATAAAGATGATGAAATAGTCTGAACCGTTTTGAGAAAAATGGAAATAAAAGTATATTTGGCTTCTAGCTGAATCTTTTATGATAACATAAATTGAACAGGCTAATTTGCGCAAGAGAGTACAAATTGAGTGCGCGGTTTGGCACCTCGATGTCGGCTTAGCTCATCCTCATGCATGCAGAAATCATGAAGGGTTCGACTGTTCGTCGATTAAAGAGCTACATGAGCTGGGTTTAATACGTCGTGAGACAGTATGGTTTCTATCTTCTAGAGGAACATAAAGTAGATTAAAGATAGCCCCTTCGTACGAAAGGAGTTGGGTATATTGATCTCTGGTTTACCTGTTGTTTATGATTTATATTATAACATATGTTATAATGATAATTAATACTTATACTAAGGTATTGTTACACTATTTATAGTATAACCAGACAACATAGGCATGGCAGGAAAGCTACATCAGTTAAAGATAAGTGTTGAAAGCATCTAAACGCGAAGCAAACTTTATGATACTTTTATACGTAGTAGAACACTACGAGCATAATTGTTTAATTACAATTAATAGGCTTTAGTTGTAAGAATGATAACATTTTTAGATATAAAGTACTAATTTAAAAAAAAAAGTATACTAAATATTATTTAATATCATTATAATATTTTTTTTATATATTACAATAAAGCCTTTTTAGCATAAAAGTAATGCAACCGTTTTGTAATCGGTAGAAGTGAGTTCGATACTCGCATAAGGCTAAATATATTTTAAAATATAATTTAAAGACCCAATGGTCAAGTATGGTTAAG >UAMH09184_GQ498978_SSU-LSU CATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAG

IMAGES:

There are no images in this gallery.