<< back to search

Search Details

add to cart



UAMH Number:9510
Species Name: Emergomyces pasteurianus
Type: Emergomyces pasteurianus
Synonyms: Emmonsia pasteuriana
Taxonomy: FUNGI Ascomycota, Eurotiomycetes, Onygenales, Ajellomycetaceae
Strain History: Gueho, E. (IP 2310-95) -> UAMH
Substrate: disseminated cutaneous lesions in a HIV+ female with a history of injection drug use, 40 years; histopathology + for yeast-like cells
Location: ITALY (GEO: 41.872,12.567)
Isolator:
Isolation Date:
Date Received: 1999-04-06
Characters: HUMAN/ ANIMAL PATHOGEN disseminated mycosis in AIDS - Gori et al., J. Mycol. Med. 8:57-63, 1998 // HUMAN/ ANIMAL PATHOGEN distinction from Emmonsia spp and Blastomyces - Drouhet et al., J. Med. Mycol. 8:64-77, 1998 // MOLECULAR SYSTEMATICS Genome Project # PRJNA234734 as strain EP 9510 // SYSTEMATICS/ TAXONOMY distinction from Emmonsia spp and Blastomyces // SYSTEMATICS/ TAXONOMY genus Emergomyces described - Dukik et al., Mycoses 60(5): 296-309, 2017
Compounds:
Cross Reference: CBS 101426
Pathogenic Potential: Human: yes | Animal: no | Plant: no
Biosafety Risk Group: RG3 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number and a CFIA Written Authorization for transfer prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 818570
Sequences: >UAMH09510_EF592152_SSU-LSU GGATCATTAACGCGCCGTGGGGGGCCGATCCCCAAACGGGACCCCGGCCCCTCCACCTGGCCACCCTTGTCTACCTCACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGCTTCGCCTCCCCGGGCCCGTGCCCGCCGGGGACACCGTAGAAAACTCTGGTTAAAGATTGACGTCTGAGAATATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGCGTCTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTGGAGGCCCGGCCGGCCCCGGCCCATTGAAACCCCGGGGAGGGAAGTCCTCGAGACCCCCTCCCCAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTCGGAGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTAGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCGTGGCCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGACC

IMAGES: