<< back to search

Search Details

add to cart



UAMH Number:9515
Species Name: Trichoderma longibrachiatum
Type:
Synonyms:
Taxonomy: FUNGI Ascomycota, Sordariomycetes, Hypocreales, Hypocreaceae
Strain History: NF 46470-98 -> Rennie, R. (MY 1793) -> UAMH
Substrate: peritoneal effluent, female
Location: CANADA Newfoundland, St. John's (GEO: 47.562,-52.713)
Isolator: NF 46470-98
Isolation Date: 1999-03-01
Date Received: 1999-04-09
Characters: APPLICATION quantitative PCR analysis of house dust - Meklin T, Haugland RA, Reponen T, Varma M et al, J Environ Monit 6:615-620, 2004 // APPLICATION rapid identification by isoenzyme analysis - Szekeres A, Laday M, Kredics L, Varga J, Antal Z, Hatvani L, Manczinger L, Vágvölgyi C, Nagy E, Clinical Microbiology and Infection 12:369-375, 2006 // BIODETERIOGEN/ BIODEGRADATION extracellular proteolytic enzymes - Kredics L, Antal Z, Szekeres A, Manczinger L, Doczi I, Kevei F, Nagi E, Acta Microbiologica et Immunologica Hungarica 51:283-295, 2004 // MOLECULAR SYSTEMATICS genetic diversity based on mitochondrial DNA profiles - Antal Z, Varga J, Kredics L, Szekeres A, Hatvani L, Manczinger L, Vágvölgyi C, Nagy E, Medical Microbiology 55:31-35, 2006 // PIGMENT slight yellow on PDA @30C after 70 hr; none @37C or 42C // THERMOTOLERANT good growth @ 37C(radius 100 mm) and 42C (radius 65 mm) after 70 hr
Compounds:
Cross Reference: MY 1793 // NF 46470-98
Pathogenic Potential: Human: yes | Animal: no | Plant: no
Biosafety Risk Group: RG2 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 340300
Sequences: >UAMH09515_EU401466 GCAACTCTGCTGCGGCAAACCTGGTAGGGAAGGCGTTTTCAGGGTGCTAACCGAGCTGCTACAGGACAAGGACGGTGATGGTACGTGACGGCGAGTGACGCGACAACACACCTATTTCTCTCTCTACGAGCCCGCACCGAAGCATTCATTGCCGATCGATAGCCCTCTCGCACGCTCGAATGATTGATAAATGGACACGATAAACTGACAGGCTTGACCCCGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGTTCCATCGACTTCCCTGGTACGTGACTTGTCGCAAGATTTGGTGGCCAAGGTATATGGGCTAACATGGAGCGGTGAAGAATTTCTCACCATGATGGCCAGAAAGATGA >UAMH09515_EU401518 AAGAGATTCGCCTCAACTGCCATCACGTTCATGAAGGATTGGGGCTTCGACGGCATCGACATCGACTGGGAATACCCTGCAGACAGCACCCAGGCCTCCAACATGATTCTTCTGCTGAAGGAAGTCCGATCTCAGCTCGACGCCTATGCCGCACAGCACGCCCCTGGCTACCACTTCCTTCTCTCCATTGCTGCCCCAGCCGGCGAGGTCAACTACTCCGTCCTGCGCCTGGCTGATCTCGGCCAAGTCCTCGACTATGTCAACCTCATGGCCTACGACTATGCCGGATCTTGGAGCAACGCCTCCGGCCACGACGCCAACTTGTATGCCAACCCGCAGAACCCCAACGCAACGCCCTTCAACACCGATGATGCTGTCAAGGCCTACATCAAGGGCGGTGTTCCTGCAAACAAGATTGTCCTCGGCATGCCCATCTATGGCCGATCCTTTGAGTCCACCTCTGGCATTGGCCAGCCCTTTAACGGAATCGGGTCTGGTAGCTGGGAGAACGGTGTCTGGGATTACAAGGCCCTGCCCAAGGCCGGCGCTACCGTCCAGTATGATGACGTCGCCAAGGCTTCCTACAGCTATGACCCCAGCACAAAG >UAMH09515_EU401598 ATCTTTTTTTTCACACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATCCTCTGCCGCCCTCTGCTCTCGTCTCCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAATGCTAATCATTTTCCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGACTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCACGGACAAGCCCCTGCGTCTGCCCCTGCAGGACGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGCATGGTCGTCACCTTCGCCCCCT >UAMH09515_AY625069_SSU-LSU TCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA >UAMH09515_AY328035_SSU-LSU AGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTACTGAAATGTTGACCTCGGATCAGGTAGGAATG

IMAGES:

There are no images in this gallery.