UofT DLSPH Webmail Portal LIMS
<< back to search

UAMH 9523 — Phialocephala fortinii

add to cart

UAMH Number:9523
Species Name: Phialocephala fortinii
Type:
Synonyms: show more
Taxonomy: FUNGI Ascomycota, Leotiomycetes, Helotiales, Mollisiaceae
Strain History: Y. Hashimoto (B-2) -> Currah, R.S. (H-46) -> UAMH
Substrate: roots of Betula platyphylla v. japonica in deciduous, broadleaf forest zone at 1300 m.
Location: JAPAN Mount Norikura (GEO: 36.108,137.55)
Isolator: Y. Hashimoto (B-2)
Isolation Date:
Date Received: 1999-04-23
Characters: CULTURE CONDITIONS cultural group 1; fast growing, producing sclerotia // MOLECULAR SYSTEMATICS RFLP & ITS sequence comparison with Leptodontidium orchidicola - Addy et al., Mycol. Res. 104:1213-1221, 2000 (Click for publications citing UAMH 9523)
Compounds:
Cross Reference:
Collections: Living Strains; Dried Herbarium Material
Pathogenic Potential: Human: no | Animal: no | Plant: yes
Biosafety Risk Group: RG1 (check the PHAC ePATHogen Risk Group Database for updates)
Regulatory Requirements: Canadian requesters must provide PHAC Pathogen and Toxin License Number (see: https://www.canada.ca/en/public-health/services/laboratory-biosafety-biosecurity/licensing-program.html) prior to shipment. International requesters must provide all legally required importation documentation prior to shipment. Plant pathogenicity status may be verified by using the USDA Agricultural Research Service (ARS) Fungal Database
MycoBank ID: 104627
NCBI Taxonomy ID: 62722
GBIF Taxon Key: 3484868
Sequences:

>UAMH09523_AF214585_SSU-LSU CATTACAAGTGAGGCTACCGAACGTTGGAAACAGCGGTTAGGAGCTTACACCCACCCGTGTTTACATACTATTGTTGCTTTGGCGGGCCGTGGCCTCCACTGCGGGCTCTGCTCGTGTGTGCCCGCCAGAGAACCAAACTCTGAATGTTAGTGATGTCTGAGTACTATTTAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTAACCACTCACGCCTAGCGTGGTATTGGGGCACGCGGTCTCCGCGGCCCTCAAAATTAGTGGCGGCGCCGGTGGGCTCTAAGCGTAGTACATACTCCCGCTATAGAGTTCCCCCCGGTGGCTCGCCAGAACCCCCAATTTTTTTTTACAGGTTGACCTCGGATCA

Images

There are no images in this gallery.